Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:16385

Mir693 microRNA 693 ( MGI:3629942)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:16385 EMAGE:16385 EMAGE:16385 EMAGE:16385 EMAGE:16385
"Pseudo-wholemount" of euxassay_019135. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019135_01 euxassay_019135_02 euxassay_019135_03 euxassay_019135_04
EMAGE:16385 EMAGE:16385 EMAGE:16385 EMAGE:16385 EMAGE:16385
euxassay_019135_05 euxassay_019135_06 euxassay_019135_07 euxassay_019135_08 euxassay_019135_09
EMAGE:16385 EMAGE:16385 EMAGE:16385 EMAGE:16385 EMAGE:16385
euxassay_019135_10 euxassay_019135_11 euxassay_019135_12 euxassay_019135_13 euxassay_019135_14
EMAGE:16385 EMAGE:16385 EMAGE:16385 EMAGE:16385 EMAGE:16385
euxassay_019135_15 euxassay_019135_16 euxassay_019135_17 euxassay_019135_18 euxassay_019135_19
EMAGE:16385 EMAGE:16385 EMAGE:16385 EMAGE:16385 EMAGE:16385
euxassay_019135_20 euxassay_019135_21 euxassay_019135_22 euxassay_019135_23 euxassay_019135_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:16385Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
16385_wholemount_strong.wlz
16385_wholemount_moderate.wlz
16385_wholemount_weak.wlz
16385_wholemount_possible.wlz
16385_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:16385_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Annotation Validation: spatial mapping by EMAGE editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:T70143
Entity Detected:Mir693, microRNA 693 ( MGI:3629942)
Sequence:sense strand is shown

>T70143
CAGCCACATCCGAAAGTTTTC
Notes:The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-693-5p was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:LNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:16384 same embryo
 EMAGE:16383 same embryo
 EMAGE:16386 same embryo
 EMAGE:16382 same embryo
 EurExpress:euxassay_019135 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS