Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:16436

Mir689-2 microRNA 689-2 ( MGI:3629928)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:16436 EMAGE:16436 EMAGE:16436 EMAGE:16436 EMAGE:16436
euxassay_019119_01 euxassay_019119_02 euxassay_019119_03 euxassay_019119_04 euxassay_019119_05
EMAGE:16436 EMAGE:16436 EMAGE:16436 EMAGE:16436 EMAGE:16436
euxassay_019119_06 euxassay_019119_07 euxassay_019119_08 euxassay_019119_09 euxassay_019119_10
EMAGE:16436 EMAGE:16436 EMAGE:16436 EMAGE:16436 EMAGE:16436
euxassay_019119_11 euxassay_019119_12 euxassay_019119_13 euxassay_019119_14 euxassay_019119_15
EMAGE:16436 EMAGE:16436 EMAGE:16436 EMAGE:16436 EMAGE:16436
euxassay_019119_16 euxassay_019119_17 euxassay_019119_18 euxassay_019119_19 euxassay_019119_20
EMAGE:16436 EMAGE:16436 EMAGE:16436 EMAGE:16436
euxassay_019119_21 euxassay_019119_22 euxassay_019119_23 euxassay_019119_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:16436Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
16436_wholemount_strong.wlz
16436_wholemount_moderate.wlz
16436_wholemount_weak.wlz
16436_wholemount_possible.wlz
16436_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:16436_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
rib
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 17 18 19 20 21 22
humerus
moderate moderate
regionalmoderate expression: see section 01 02 20 21 22 23 weak expression: see section 03 24
hindlimb digit 2 metatarsal
moderate moderate
regionalmoderate expression: see section 21
hindlimb digit 3 metatarsal
moderate moderate
regionalmoderate expression: see section 21
hindlimb digit 4 metatarsal
moderate moderate
regionalmoderate expression: see section 21
fibula
weak weak
regionalweak expression: see section 01 23 24
tibia
weak weak
regionalweak expression: see section 01 23
femur
moderate moderate
regionalmoderate expression: see section 03 04 05 20 21 22 weak expression: see section 02
vibrissa
strong strong
regionalstrong expression: see section 05 21 22 moderate expression: see section 06 07
meckel's cartilage
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 17 18 19 20 weak expression: see section 13 14 15 16
clavicle
weak weak
regionalweak expression: see section 07 08 09 15
scapula
moderate moderate
regionalmoderate expression: see section 02 03 20 21
pelvic girdle skeleton
moderate moderate
regionalmoderate expression: see section 09 16 19 weak expression: see section 08
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T70138
Entity Detected:Mir689-2, microRNA 689-2 ( MGI:3629928)
Sequence:sense strand is shown

>T70138
CGTCCCCGCTCGGCGGGGTCC
Notes:The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-689 was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:LNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:16437 same assay
 EMAGE:16438 same embryo
 EMAGE:16434 same embryo
 EMAGE:16435 same embryo
 EurExpress:euxassay_019119 same experiment
 EMAGE:16433 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS