Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:17682

Cxcr4 chemokine (C-X-C motif) receptor 4 ( MGI:109563)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:17682 EMAGE:17682 EMAGE:17682 EMAGE:17682 EMAGE:17682
"Pseudo-wholemount" of euxassay_006007. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_006007_01 euxassay_006007_02 euxassay_006007_03 euxassay_006007_04
EMAGE:17682 EMAGE:17682 EMAGE:17682 EMAGE:17682 EMAGE:17682
euxassay_006007_05 euxassay_006007_06 euxassay_006007_07 euxassay_006007_08 euxassay_006007_09
EMAGE:17682 EMAGE:17682 EMAGE:17682 EMAGE:17682 EMAGE:17682
euxassay_006007_10 euxassay_006007_11 euxassay_006007_12 euxassay_006007_13 euxassay_006007_14
EMAGE:17682 EMAGE:17682 EMAGE:17682 EMAGE:17682 EMAGE:17682
euxassay_006007_15 euxassay_006007_16 euxassay_006007_17 euxassay_006007_18 euxassay_006007_19
EMAGE:17682 EMAGE:17682 EMAGE:17682 EMAGE:17682 EMAGE:17682
euxassay_006007_20 euxassay_006007_21 euxassay_006007_22 euxassay_006007_23 euxassay_006007_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:17682Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
17682_wholemount_strong.wlz
17682_wholemount_moderate.wlz
17682_wholemount_weak.wlz
17682_wholemount_possible.wlz
17682_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:17682_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14
vibrissa
moderate moderate
regionalmoderate expression: see section 07 08 09 10 22 23
hypothalamus ventricular layer
moderate moderate
regionalmoderate expression: see section 11 12 13 14
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 10 11 12 13
corpus striatum
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 19 20 21
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 15 16 18
medulla oblongata basal plate ventricular layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14
rest of cerebellum ventricular layer
strong strong
homogeneousstrong expression: see section 02 17 18 19 moderate expression: see section 03 04 05 12 13 14 15 weak expression: see section 16
pons ventricular layer
strong strong
homogeneousstrong expression: see section 17 moderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 weak expression: see section 16
midbrain ventricular layer
moderate moderate
homogeneousmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15
spinal cord ventricular layer
moderate moderate
regionalmoderate expression: see section 09 10 11
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 14 weak expression: see section 08 09
cervical ganglion
moderate moderate
regionalmoderate expression: see section 15 weak expression: see section 08 09
thoracic ganglion
weak weak
regionalweak expression: see section 13
neural retina
strong strong
regionalstrong expression: see section 02 03 04 23 24
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 10 11 12 13 15 16 18 19 weak expression: see section 17
not examined not examined
regionalnot examined expression: see section 09 10 13
mitral valve
strong strong
regionalstrong expression: see section 10 13 moderate expression: see section 09
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 12 13 16 17
lower jaw molar
moderate moderate
regionalmoderate expression: see section 19 20
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 12 13 16 17 18
upper jaw molar
moderate moderate
regionalmoderate expression: see section 19 20
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T265
Entity Detected:Cxcr4, chemokine (C-X-C motif) receptor 4 ( MGI:109563)
Sequence:sense strand is shown

>T265
GCAGGTAGCAGTGACCCTCTGAGGCGTTTGGTGCTCCGGTAACCACCACGGCTGTAGAGCGAGTGTTGCC
ATGGAACCGATCAGTGTGAGTATATACACTTCTGATAACTACTCTGAAGAAGTGGGGTCTGGAGACTATG
ACTCCAACAAGGAACCCTGCTTCCGGGATGAAAACGTCCATTTCAATAGGATCTTCCTGCCCACCATCTA
CTTCATCATCTTCTTGACTGGCATAGTCGGCAATGGATTGGTGATCCTGGTCATGGGTTACCAGAAGAAG
NTAAGGAGCATGACGGACAAGTACCGGCTGCACCTGTCAGTGGCTGACCTCCTCTTTGTCATCACACTCC
CCTTCTGGGCAGTTGATGCCATGGCTGACTGGTACTTTGGGAAATTTTTGTGTAAGGCTGTCCATATCAT
CTACACTGTCAACCTCTACAGCAGCGTTCTCATCCTGGCCTTCATCAGCCTGGACCGGTACCTCGCCATT
GTCCACGCCACCAA
Notes:The probe template was PCR amplified from IMAGE:2654812 using vector specific primers. Forward Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2654812 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:17683 same embryo
 EMAGE:17684 same embryo
 EurExpress:euxassay_006007 same experiment
 MGI:4824136 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS