Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:17793

Myf6 myogenic factor 6 ( MGI:97253)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:17793 EMAGE:17793 EMAGE:17793 EMAGE:17793 EMAGE:17793
"Pseudo-wholemount" of euxassay_008954. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_008954_01 euxassay_008954_02 euxassay_008954_03 euxassay_008954_04
EMAGE:17793 EMAGE:17793 EMAGE:17793 EMAGE:17793 EMAGE:17793
euxassay_008954_05 euxassay_008954_06 euxassay_008954_07 euxassay_008954_08 euxassay_008954_09
EMAGE:17793 EMAGE:17793 EMAGE:17793 EMAGE:17793 EMAGE:17793
euxassay_008954_10 euxassay_008954_11 euxassay_008954_12 euxassay_008954_13 euxassay_008954_14
EMAGE:17793 EMAGE:17793 EMAGE:17793 EMAGE:17793 EMAGE:17793
euxassay_008954_15 euxassay_008954_16 euxassay_008954_17 euxassay_008954_18 euxassay_008954_19
EMAGE:17793 EMAGE:17793 EMAGE:17793 EMAGE:17793
euxassay_008954_20 euxassay_008954_21 euxassay_008954_22 euxassay_008954_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:17793Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
17793_wholemount_strong.wlz
17793_wholemount_moderate.wlz
17793_wholemount_weak.wlz
17793_wholemount_possible.wlz
17793_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:17793_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
brain
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 10 11 12 13 14 15 16 17 18 19 20 21 22 23
facial vii ganglion
strong strong
regionalstrong expression: see section 03 04 19 20
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 06
trigeminal v ganglion
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 16 17 18 19 20
vagus x ganglion
strong strong
regionalstrong expression: see section 06 07
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 05 moderate expression: see section 06
spinal cord
strong strong
regionalstrong expression: see section 05 06 07 08 10 11 12 13 14 15 16 17
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 08 14
cervical ganglion
moderate moderate
regionalmoderate expression: see section 07 08 15
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 13 14
dorsal root ganglion
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17
neural retina
strong strong
regionalstrong expression: see section 02 03 04 05 23
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 16 17 18 19 20
vomeronasal organ
strong strong
regionalstrong expression: see section 14 16 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35493
Entity Detected:Myf6, myogenic factor 6 ( MGI:97253)
Sequence:sense strand is shown

>T35493
TACAGCTACAAACCCAAGCAAGAAATTCTTGAGGGTGCGGATTTCCTGCGCACCTGCAGCCCCCAGTGGC
CAAGTGTTTCGGATCATTCCAGGGGCCTCGTGATAACTGCTAAGGAAGGAGGAGCAAACGTGGATGCCTC
AGCCTCCAGCAGTCTTCAGCGCCTTTCTTCCATCGTGGACAGTATTTCTTCAGAGGAACGCAAACTCCCC
AGCGTGGAGGAGGTGGTGGAGAAGTAACTCAGCCAGCATTTGGAACATTCTTCACCCAGCAGGAAGACCC
CCCTTTCCACCTAATCATTTAGATTAGGGCTCACAGATGCCAGCTTTTATGAAAGGCGAGAGATTTAGTA
TTTAAAAAGAAACTTCTCACCACCTCAAGTGAAAGTCCTTCGCCTTGGGGCTTTTATTATGATACTTATT
ATTATATCGGAACGCCTAGTAGCTTAGCTCTAGAACCCTGATTTTGTTTTTAGTTTGGTTGGTTTTAATA
ACATATTAACTTTTACTATGATCACGTGACCC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 89606. Forward Primer - name:089606_F_cDNA_Myf6, sequence:TACAGCTACAAACCCAAGCAAG; Reverse Primer - name:089606_N_SP6_cDNA_Myf6, sequence:GGGTCACGTGATCATAGTAAAAG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:17796 same embryo
 EMAGE:17795 same embryo
 EMAGE:17792 same embryo
 EMAGE:17794 same embryo
 EMAGE:17797 same embryo
 EurExpress:euxassay_008954 same experiment
 MGI:4826539 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS