Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:17841

Gfra2 glial cell line derived neurotrophic factor family receptor alpha 2 ( MGI:1195462)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:17841 EMAGE:17841 EMAGE:17841 EMAGE:17841 EMAGE:17841
"Pseudo-wholemount" of euxassay_009048. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009048_01 euxassay_009048_02 euxassay_009048_03 euxassay_009048_04
EMAGE:17841 EMAGE:17841 EMAGE:17841 EMAGE:17841 EMAGE:17841
euxassay_009048_05 euxassay_009048_06 euxassay_009048_07 euxassay_009048_08 euxassay_009048_09
EMAGE:17841 EMAGE:17841 EMAGE:17841 EMAGE:17841 EMAGE:17841
euxassay_009048_10 euxassay_009048_11 euxassay_009048_12 euxassay_009048_13 euxassay_009048_14
EMAGE:17841 EMAGE:17841 EMAGE:17841 EMAGE:17841 EMAGE:17841
euxassay_009048_15 euxassay_009048_16 euxassay_009048_17 euxassay_009048_18 euxassay_009048_19
EMAGE:17841 EMAGE:17841 EMAGE:17841 EMAGE:17841 EMAGE:17841
euxassay_009048_20 euxassay_009048_21 euxassay_009048_22 euxassay_009048_23 euxassay_009048_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:17841Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
17841_wholemount_strong.wlz
17841_wholemount_moderate.wlz
17841_wholemount_weak.wlz
17841_wholemount_possible.wlz
17841_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:17841_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
vibrissa
moderate moderate
regionalmoderate expression: see section 06 07 08 20 21 22 23
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 15 16 17 18
trigeminal v ganglion
moderate moderate
single cellmoderate expression: see section 03 04 05 06 07 08 09 17 18 19 20 21 22
ventral grey horn
moderate moderate
single cellmoderate expression: see section 08 09 10 11 12 13 14
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 14 15 16
mandible
moderate moderate
regionalmoderate expression: see section 08 19 20 weak expression: see section 06 09 16 17 18 21
maxilla
weak weak
regionalweak expression: see section 06 07 21
genital tubercle of male
weak weak
regionalweak expression: see section 12 13 14 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36426
Entity Detected:Gfra2, glial cell line derived neurotrophic factor family receptor alpha 2 ( MGI:1195462)
Sequence:sense strand is shown

>T36426
CTCCTCCTACATCTCCATCTGCAACCGCGAGATCTCTCCCACTGAACGCTGCAACCGCCGCAAGTGCCAC
AAGGCCCTGCGCCAGTTCTTCGACCGTGTGCCCAGCGAGTATACCTACCGCATGCTCTTCTGCTCCTGTC
AGGACCAGGCATGCGCCGAGCGTCGCCGGCAAACCATCCTGCCCAGCTGTTCCTATGAGGACAAGGAGAA
GCCCAACTGCTTGGACCTGCGCAGCCTGTGTCGTACAGACCACTTGTGCCGGTCCCGCCTGGCAGACTTC
CACGCCAACTGTCGAGCCTCCTACCGGACAATCACCAGCTGCCCTGCGGACAACTACCAGGCATGTCTGG
GCTCCTATGCTGGCATGATTGGGTTTGATATGACACCGAACTATGTGGACTCCAACCCCACGGGCATCGT
GGTGTCTCCCTGGTGCAATTGTCGTGGCAGTGGGAACATGGAAGAAGAGTGTGAGAAGTTCCTCAAGGAC
TTCACAGAAAACCCATGCCTCCGGAATGCCATTCAAGCCTTTGGCAATGGCACAGATGTGAACATGTCTC
CCAAAGGCCCCACATTTTCAGCTACCCAGGC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 97764. Forward Primer - name:097764_F_cDNA_Gfra2, sequence:CTCCTCCTACATCTCCATCTGC; Reverse Primer - name:097764_N_SP6_cDNA_Gfra2, sequence:GCCTGGGTAGCTGAAAATGTG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:17843 same embryo
 EMAGE:17844 same embryo
 EMAGE:17842 same embryo
 EMAGE:17840 same embryo
 EurExpress:euxassay_009048 same experiment
 MGI:4825048 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS