Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:17934

Dlg2 discs, large homolog 2 (Drosophila) ( MGI:1344351)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:17934 EMAGE:17934 EMAGE:17934 EMAGE:17934 EMAGE:17934
"Pseudo-wholemount" of euxassay_011686. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011686_01 euxassay_011686_02 euxassay_011686_03 euxassay_011686_04
EMAGE:17934 EMAGE:17934 EMAGE:17934 EMAGE:17934 EMAGE:17934
euxassay_011686_05 euxassay_011686_06 euxassay_011686_07 euxassay_011686_08 euxassay_011686_09
EMAGE:17934 EMAGE:17934 EMAGE:17934 EMAGE:17934 EMAGE:17934
euxassay_011686_10 euxassay_011686_11 euxassay_011686_12 euxassay_011686_13 euxassay_011686_14
EMAGE:17934 EMAGE:17934 EMAGE:17934 EMAGE:17934 EMAGE:17934
euxassay_011686_15 euxassay_011686_16 euxassay_011686_17 euxassay_011686_18 euxassay_011686_19
EMAGE:17934 EMAGE:17934 EMAGE:17934 EMAGE:17934 EMAGE:17934
euxassay_011686_20 euxassay_011686_21 euxassay_011686_22 euxassay_011686_23 euxassay_011686_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:17934Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
17934_wholemount_strong.wlz
17934_wholemount_moderate.wlz
17934_wholemount_weak.wlz
17934_wholemount_possible.wlz
17934_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:17934_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall mantle layer
moderate moderate
single cellmoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18
olfactory cortex marginal layer
moderate moderate
single cellmoderate expression: see section 10 11 12 13
medulla oblongata basal plate mantle layer
moderate moderate
single cellmoderate expression: see section 08 09 10 11 12 14 15 16 17
medulla oblongata basal plate marginal layer
moderate moderate
single cellmoderate expression: see section 13
pons mantle layer
moderate moderate
single cellmoderate expression: see section 08 09 10 14 15 16 17 18 19
midbrain mantle layer
moderate moderate
single cellmoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18
trigeminal v nerve
strong strong
regionalstrong expression: see section 10 17 moderate expression: see section 09 weak expression: see section 16
ventral grey horn
moderate moderate
single cellmoderate expression: see section 08 09 10 11 12 13 14
cervico-thoracic ganglion
weak weak
regionalweak expression: see section 08 09 14
cervical ganglion
weak weak
regionalweak expression: see section 08 15
thoracic ganglion
weak weak
regionalweak expression: see section 12 13
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15
mandible
weak weak
regionalweak expression: see section 05 06 07 08 19 20 21
maxilla
weak weak
regionalweak expression: see section 07 08 20 21
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37676
Entity Detected:Dlg2, discs, large homolog 2 (Drosophila) ( MGI:1344351)
Sequence:sense strand is shown

>T37676
TTGCAAGTAGGAGACAGACTGCTAATGGTAAATAACTATAGTTTAGAAGAAGTTACACACGAAGAGGCTG
TAGCGATATTGAAGAACACATCTGATGTTGTTTATCTAAAAGTTGGCAAACCCACCACTATTTATATGAC
TGATCCTTATGGGCCACCGGATATTACTCACTCTTATTCTCCACCGACGGAAAATCATCTACTGTCTGGC
AACAATGGCACATTAGAATACAAGACTTCCCTGCCGCCCATCCCTCCAGGAAGGTACTCACCAATTCCCA
AGCACATGCTGGGTGAAGATGACTACACCAGGCCGCCGGAACCTGTTTACAGCACTGTGAATAAACTGTG
TGATAAGCCTGCTTCTCCCAGGCACTATTCCCCTGTTGAGTGTGACAAAAGCTTCCT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 90521. Forward Primer - name:090521_F_cDNA_Dlgh2, sequence:TTGCAAGTAGGAGACAGACTGC; Reverse Primer - name:090521_N_SP6_cDNA_Dlgh2, sequence:AGGAAGCTTTTGTCACACTCA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:17933 same embryo
 EMAGE:17936 same embryo
 EMAGE:17932 same embryo
 EMAGE:17935 same embryo
 EurExpress:euxassay_011686 same experiment
 MGI:4824321 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS