Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:17952

Thbs4 thrombospondin 4 ( MGI:1101779)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:17952 EMAGE:17952 EMAGE:17952 EMAGE:17952 EMAGE:17952
"Pseudo-wholemount" of euxassay_011724. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011724_01 euxassay_011724_02 euxassay_011724_03 euxassay_011724_04
EMAGE:17952 EMAGE:17952 EMAGE:17952 EMAGE:17952 EMAGE:17952
euxassay_011724_06 euxassay_011724_07 euxassay_011724_08 euxassay_011724_09 euxassay_011724_10
EMAGE:17952 EMAGE:17952 EMAGE:17952 EMAGE:17952 EMAGE:17952
euxassay_011724_11 euxassay_011724_12 euxassay_011724_13 euxassay_011724_14 euxassay_011724_15
EMAGE:17952 EMAGE:17952 EMAGE:17952 EMAGE:17952 EMAGE:17952
euxassay_011724_16 euxassay_011724_17 euxassay_011724_18 euxassay_011724_19 euxassay_011724_20
EMAGE:17952 EMAGE:17952 EMAGE:17952 EMAGE:17952
euxassay_011724_21 euxassay_011724_22 euxassay_011724_23 euxassay_011724_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:17952Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
17952_wholemount_strong.wlz
17952_wholemount_moderate.wlz
17952_wholemount_weak.wlz
17952_wholemount_possible.wlz
17952_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:17952_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
upper arm muscle
strong strong
regionalstrong expression: see section 01 02 03 04 05 20 21 22 23 24
upper leg muscle
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 19 20 21 22 23 24
forearm rest of mesenchyme
strong strong
regionalstrong expression: see section 01 02
lower leg rest of mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 04 22 23 24
axial muscle
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
cranial muscle
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
pectoral girdle and thoracic body wall muscle
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
diencephalon meninges
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16 17 18 weak expression: see section 07 08 09
telencephalon meninges
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16 17 18 19 20 weak expression: see section 08 09
midbrain meninges
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16 17 18 weak expression: see section 04 05 06 07 08 09
endocardial tissue
weak weak
regionalweak expression: see section 07 08 09 10 11 12 13 14 15 16
esophagus
strong strong
regionalstrong expression: see section 11 12
tongue muscle
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 16
midgut
moderate moderate
regionalmoderate expression: see section 13 14 15 16 17
tail paraxial mesenchyme
strong strong
regionalstrong expression: see section 12 13 14 15 16 17 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37135
Entity Detected:Thbs4, thrombospondin 4 ( MGI:1101779)
Sequence:sense strand is shown

>T37135
GTTACCCTGATGAAGAACTGCCATGCTCTGCCAGGAACTGCAAGAAGGATAACTGCAAGTATGTGCCAAA
CTCTGGCCAGGAAGATGCAGACAGAGATGGCATCGGAGACGCGTGTGATGAGGATGCAGATGGAGATGGG
ATCTTGAATGAACAGGACAACTGTGTCCTGACTCACAATATAGACCAAAGGAACAGTGATAAAGATATCT
TTGGGGATGCCTGTGACAACTGCCGGATGGTCCTGAATAATGACCAGAAGGATACTGACGGGGATGGGAG
AGGAGACGCCTGTGATGACGACATGGATGGAGATGGAATAAAAAACATTTTGGACAACTGTCCCAGAGTT
CCCAACCGTGACCAGCAGGATCGGGATGGTGATGATGTCGGAGACGCTTGTGACAGCTGTCCTGATGTCA
GTAACCCTAACCAGTCGGATGTGGATAACGATCTGGTTGGGGACTCCTGTGACACCAACCAAGACAGTGA
CGGGGATGGCCACCAGGACAGCACAGACAACTGCCCCACAGTCATTAACAGCTCCCAGCTGGACACTGAC
AAAGATGGGATCGGCGATGAATGTGATGACGATGACGATAACGATGGCATCCCAGACCTGGTGCCTCCTG
GCCCAGACAACTGCAGGCTCGTCCCCAACCCAGCCCAGGAAGATAGCAACAAT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 64255. Forward Primer - name:064255_F_cDNA_Thbs4, sequence:GTTACCCTGATGAAGAACTGCC; Reverse Primer - name:064255_N_SP6_cDNA_Thbs4, sequence:ATTGTTGCTATCTTCCTGGGC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:17950 same embryo
 EMAGE:17951 same embryo
 EMAGE:17948 same embryo
 EMAGE:17949 same embryo
 EurExpress:euxassay_011724 same experiment
 MGI:4828695 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS