Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18252

Ccl27a chemokine (C-C motif) ligand 27A ( MGI:1343459)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18252 EMAGE:18252 EMAGE:18252 EMAGE:18252 EMAGE:18252
euxassay_012042_01 euxassay_012042_02 euxassay_012042_03 euxassay_012042_04 euxassay_012042_05
EMAGE:18252 EMAGE:18252 EMAGE:18252 EMAGE:18252 EMAGE:18252
euxassay_012042_06 euxassay_012042_07 euxassay_012042_08 euxassay_012042_09 euxassay_012042_10
EMAGE:18252 EMAGE:18252 EMAGE:18252 EMAGE:18252 EMAGE:18252
euxassay_012042_11 euxassay_012042_12 euxassay_012042_13 euxassay_012042_14 euxassay_012042_15
EMAGE:18252 EMAGE:18252 EMAGE:18252 EMAGE:18252 EMAGE:18252
euxassay_012042_16 euxassay_012042_17 euxassay_012042_18 euxassay_012042_19 euxassay_012042_20
EMAGE:18252 EMAGE:18252
euxassay_012042_21 euxassay_012042_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18252Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18252_wholemount_strong.wlz
18252_wholemount_moderate.wlz
18252_wholemount_weak.wlz
18252_wholemount_possible.wlz
18252_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18252_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 14 15 20 21 22 weak expression: see section 01 02 03 16 17 18 19
humerus
moderate moderate
regionalmoderate expression: see section 01 02 03 20 21 22
hip
moderate moderate
regionalmoderate expression: see section 11 16
fibula
moderate moderate
regionalmoderate expression: see section 03 04
tibia
moderate moderate
regionalmoderate expression: see section 02 03 04 05
femur
moderate moderate
regionalmoderate expression: see section 03 04 05 07 08 09 19 20 21 22
otic capsule
weak weak
regionalweak expression: see section 08 09 10 14 15
meckel's cartilage
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
axial skeleton
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13
basioccipital bone
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15
basisphenoid bone
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14
exoccipital bone
moderate moderate
regionalmoderate expression: see section 03 04 05 15 16 17 18 19
temporal bone
moderate moderate
regionalmoderate expression: see section 02 03 04 05 18 weak expression: see section 20 21
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 02 03 08 18 19 weak expression: see section 20
viscerocranium
moderate moderate
regionalExpression in the turbinate bone.
scapula
moderate moderate
regionalmoderate expression: see section 01 02 19
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T8379
Entity Detected:Ccl27a, chemokine (C-C motif) ligand 27A ( MGI:1343459)
Sequence:sense strand is shown

>T8379
GCATGATGGAGGGGCTCTCCCCCGCCAGCAGCCTCCCGCTGTTACTGTTGCTTCTGAGCCCGGCTCCTGA
AGCAGCCTTGCCTCTGCCCTCCAGCACTAGCTGCTGTACTCAGCTCTATAGACAGCCACTCCCAAGCAGG
CTGCTGAGGAGGATTGTCCACATGGAACTGCAGGAGGCTGATGGGGACTGTCACCTCCAGGCTGTCGTGC
TTCACCTGGCTCGGCGCAGTGTCTGTGTTCATCCCCAGAACCGCAGCCTGGCTCGGTGGTTAGAACGCCA
AGGGAAAAGGCTCCAAGGAACTGTACCCAGTTTAAATCTGGTACTACAAAAGAAAATGTACTCACACCCC
CAACAGCAAAACTAATAAAGCAACATTAGACGACAAAAAAAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:3471454 using vector (pT7T3D-PacI) specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T7 polymerase. EMAGE Editor's Note: the probe sequence indicated here was given by the EURExpress Consortium and has been checked using a computational method whereby a BLAST comparison was made against the full insert sequence of IMAGE:3471454 which was retrieved directly from NCBI.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18253 same assay
 EMAGE:18256 same embryo
 EMAGE:18257 same embryo
 EMAGE:18255 same embryo
 EMAGE:18251 same embryo
 EurExpress:euxassay_012042 same experiment
 MGI:4823702 same experiment
 MGI:4823701 same experiment
 EMAGE:18254 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS