Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18275

Itga6 integrin alpha 6 ( MGI:96605)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18275 EMAGE:18275 EMAGE:18275 EMAGE:18275 EMAGE:18275
"Pseudo-wholemount" of euxassay_012071. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012071_01 euxassay_012071_02 euxassay_012071_03 euxassay_012071_04
EMAGE:18275 EMAGE:18275 EMAGE:18275 EMAGE:18275 EMAGE:18275
euxassay_012071_05 euxassay_012071_06 euxassay_012071_07 euxassay_012071_08 euxassay_012071_09
EMAGE:18275 EMAGE:18275 EMAGE:18275 EMAGE:18275 EMAGE:18275
euxassay_012071_10 euxassay_012071_11 euxassay_012071_12 euxassay_012071_13 euxassay_012071_14
EMAGE:18275 EMAGE:18275 EMAGE:18275 EMAGE:18275 EMAGE:18275
euxassay_012071_15 euxassay_012071_16 euxassay_012071_17 euxassay_012071_18 euxassay_012071_19
EMAGE:18275 EMAGE:18275 EMAGE:18275 EMAGE:18275 EMAGE:18275
euxassay_012071_20 euxassay_012071_21 euxassay_012071_22 euxassay_012071_23 euxassay_012071_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18275Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18275_wholemount_strong.wlz
18275_wholemount_moderate.wlz
18275_wholemount_weak.wlz
18275_wholemount_possible.wlz
18275_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18275_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
adrenal cortex
moderate moderate
regionalmoderate expression: see section 07 08 15 weak expression: see section 14
pancreas
moderate moderate
regionalmoderate expression: see section 09 10 11
hypothalamus mantle layer
strong strong
regionalstrong expression: see section 10 moderate expression: see section 11 12 15
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 12 13 14 15
medulla oblongata alar plate mantle layer
moderate moderate
regionalmoderate expression: see section 09 14 weak expression: see section 08
ventral grey horn
moderate moderate
regionalmoderate expression: see section 08 13 weak expression: see section 09 10 11
heart ventricle
moderate moderate
regionalmoderate expression: see section 08 09 10 11 weak expression: see section 12 13 14 15 16
rectum
moderate moderate
regionalmoderate expression: see section 12
lower jaw incisor
strong strong
regionalstrong expression: see section 12 13 15 16
lower jaw molar
moderate moderate
regionalmoderate expression: see section 08
upper jaw incisor
strong strong
regionalstrong expression: see section 12 13 16 17
upper jaw molar
moderate moderate
regionalmoderate expression: see section 08
metanephros
strong strong
regionalstrong expression: see section 07 08 moderate expression: see section 16 weak expression: see section 14 15 17
genital tubercle of male
moderate moderate
regionalmoderate expression: see section 12 13 14 15
lung
moderate moderate
regionalmoderate expression: see section 05 06 07 08 13 14 15 weak expression: see section 09 16 17 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30696
Entity Detected:Itga6, integrin alpha 6 ( MGI:96605)
Sequence:sense strand is shown

>T30696
GCAGATGGGTGGCAAGACATTGTTATCGGAGCTCCACAGTATTTTGATAGGGATGGTGAAGTCGGGGGTG
CAGTTTACGTCTACATTAACCAGCAAGGCAAATGGAGTAATGTGAAGCCGATTCGTCTAAATGGGACCAA
AGACTCGATGTTTGGAATCTCTGTGAAAAATATAGGTGATATTAACCAAGATGGCTATCCAGATATTGCT
GTTGGAGCTCCCTATGATGATCTGGGGAAGGTTTTTATCTATCATGGATCCCCGACTGGCATAATTACCA
AGCCAACACAGGTTCTCGAGGGGACATCGCCTTACTTCGGCTATTCAATCGCTGGGAATATGGACCTGGA
TCGGAATTCCTACCCCGACCTTGCTGTGGGCTCCCTCTCAGACTCGGTCACTATTTTCAGATCCCGGCCA
GTGATTAACATTCTAAAAACCATCACAGTGACTCCTAACAGAATTGACCTCCGCCAGAAGTCCATGTGTG
GCTCACCTAGCGGGATATGCCTCAAGGTTAAAGCCTGTTTTGAATATACTGCGAAACCTTCCGGTTATAA
CCCTCCAATATCAATTTTGGGTATTCTCGAAGCTGAAAAAGAAAGAAGAAAGTCAGGGTTGTCATCGAGA
GTTCAGTTTCGAAACCAAGGTTCCGAGCCAAAGTATACTCAGGAGCTGACCCTGAATCGGCAGAAGCAGC
GGGCGTGCATGGAGGAGACCCTCTGGCTGCAGGAGAACATCAGAGACAAGCTGCGTCCCATCCCCATCAC
GGCTTCTGTGGAGATCCAGGAGCCCAGCTC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:6826609), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 59712. Forward Primer - name:059712_F_IRAV118_e10_Itga6, sequence:GCAGATGGGTGGCAAGAC; Reverse Primer - name:059712_R_SP6_IRAV118_e10_Itga6, sequence:AGAGCTGGGCTCCTGGAT. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18278 same embryo
 EMAGE:18277 same embryo
 EMAGE:18276 same embryo
 EMAGE:18279 same embryo
 EurExpress:euxassay_012071 same experiment
 MGI:4825644 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS