Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18297

Noa1 nitric oxide associated 1 ( MGI:1914306)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18297 EMAGE:18297 EMAGE:18297 EMAGE:18297 EMAGE:18297
"Pseudo-wholemount" of euxassay_012087. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012087_01 euxassay_012087_02 euxassay_012087_03 euxassay_012087_04
EMAGE:18297 EMAGE:18297 EMAGE:18297 EMAGE:18297 EMAGE:18297
euxassay_012087_05 euxassay_012087_06 euxassay_012087_07 euxassay_012087_08 euxassay_012087_09
EMAGE:18297 EMAGE:18297 EMAGE:18297 EMAGE:18297 EMAGE:18297
euxassay_012087_10 euxassay_012087_11 euxassay_012087_12 euxassay_012087_13 euxassay_012087_14
EMAGE:18297 EMAGE:18297 EMAGE:18297 EMAGE:18297 EMAGE:18297
euxassay_012087_15 euxassay_012087_16 euxassay_012087_17 euxassay_012087_18 euxassay_012087_19
EMAGE:18297 EMAGE:18297 EMAGE:18297 EMAGE:18297 EMAGE:18297
euxassay_012087_20 euxassay_012087_21 euxassay_012087_22 euxassay_012087_23 euxassay_012087_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18297Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18297_wholemount_strong.wlz
18297_wholemount_moderate.wlz
18297_wholemount_weak.wlz
18297_wholemount_possible.wlz
18297_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18297_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
strong strong
regionalstrong expression: see section 09 17 18 moderate expression: see section 01 02 06 07 10 11 19 21 22 23 weak expression: see section 03 05 08 20 24
humerus
strong strong
regionalstrong expression: see section 22 23 24 moderate expression: see section 01 02 03 05 weak expression: see section 04
fibula
moderate moderate
regionalmoderate expression: see section 01 02
tibia
moderate moderate
regionalmoderate expression: see section 01 02 weak expression: see section 03
femur
strong strong
regionalstrong expression: see section 06 07 21 22 23 moderate expression: see section 03 04 05 19 20 24 weak expression: see section 02
otic capsule
weak weak
regionalweak expression: see section 06 07 08 09 16 17 18
meckel's cartilage
strong strong
regionalstrong expression: see section 05 06 07 08 09 17 18 19 21 22 moderate expression: see section 10 11 13 15 16 20 weak expression: see section 03 04
axial skeleton
strong strong
regionalstrong expression: see section 09 13 14 15 16 17 18 moderate expression: see section 10 11 12 19
basioccipital bone
strong strong
regionalstrong expression: see section 09 13 14 15 16 18 moderate expression: see section 08 10 11 12
basisphenoid bone
strong strong
regionalstrong expression: see section 13 14 moderate expression: see section 10 11 12
exoccipital bone
strong strong
regionalstrong expression: see section 05 06 21 moderate expression: see section 01 02 03 07 19 20 22 weak expression: see section 04
temporal bone
strong strong
regionalstrong expression: see section 05 06 21 moderate expression: see section 01 02 03 20 22 23 24 weak expression: see section 04
vault of skull
moderate moderate
regionalmoderate expression: see section 23 24
orbito-sphenoid
strong strong
regionalstrong expression: see section 05 06 18 moderate expression: see section 01 02 07 19 23 24
viscerocranium
strong strong
regionalExpression in the turbinate bone.
clavicle
moderate moderate
regionalmoderate expression: see section 06 07 21
scapula
strong strong
regionalstrong expression: see section 05 22 23 moderate expression: see section 24 weak expression: see section 04
pelvic girdle skeleton
strong strong
regionalstrong expression: see section 09 10 16 moderate expression: see section 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T283
Entity Detected:Noa1, nitric oxide associated 1 ( MGI:1914306)
Sequence:sense strand is shown

>T283
GGGCTGCTCTGCGGGCTCCGGCGGGGCCCCGCGCCGGCCGCTGCGTGCTACGGCCCAGCACGGTGGCTTC
TGGAGGGGAAGTGTGAGGTCCCCATCCGCCAGCGTGCATCATCCTTGGGCCGTCGGGTTCCCCCGAGCTC
CACGGCGACCGAGGACTATGCAGAAGGCCCGGACACGGAGGAACGCTTTCTGTTCCCGGAGTACGTCCCG
GAGCGGACCCCGGAGGAACAAGTGCGGGAGTTGCAGGAGCTGCGGGAGTTGCAGCAGCTGCAGCAGGAGA
AGGAACGAGAGAGATTGCAGCAGCGGGAGGAGCGGCTTCAGCAGAAGCTGCGGGCGGGCTTCCGGACGCT
GCCTGTCCCGGAGTTTCCAGACGCCTCGGTGCCGCCCAGCGGCATCTACTGCTCGGGCTGCGGAGCCGAG
CTGCACTGCCAGCATCCCGGCCTGCCGGGCTACCTGCCGGAGGAGAAGTTCCGCGACGCTGCCCAGGCGG
AAGGCGGCCCGGCGCGGACCGTGTGCC
Notes:The probe template was PCR amplified from IMAGE:2655870 using vector specific primers. Forward Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2655870 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18296 same embryo
 EMAGE:18298 same embryo
 EMAGE:18294 same embryo
 EMAGE:18293 same embryo
 EMAGE:18295 same embryo
 EurExpress:euxassay_012087 same experiment
 MGI:4822677 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS