Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18905

Cobl cordon-bleu ( MGI:105056)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18905 EMAGE:18905 EMAGE:18905 EMAGE:18905 EMAGE:18905
"Pseudo-wholemount" of euxassay_014151. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_014151_01 euxassay_014151_02 euxassay_014151_03 euxassay_014151_04
EMAGE:18905 EMAGE:18905 EMAGE:18905 EMAGE:18905 EMAGE:18905
euxassay_014151_05 euxassay_014151_06 euxassay_014151_07 euxassay_014151_08 euxassay_014151_09
EMAGE:18905 EMAGE:18905 EMAGE:18905 EMAGE:18905 EMAGE:18905
euxassay_014151_10 euxassay_014151_11 euxassay_014151_12 euxassay_014151_13 euxassay_014151_14
EMAGE:18905 EMAGE:18905 EMAGE:18905 EMAGE:18905 EMAGE:18905
euxassay_014151_15 euxassay_014151_16 euxassay_014151_17 euxassay_014151_18 euxassay_014151_19
EMAGE:18905 EMAGE:18905 EMAGE:18905 EMAGE:18905
euxassay_014151_20 euxassay_014151_21 euxassay_014151_22 euxassay_014151_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18905Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18905_wholemount_strong.wlz
18905_wholemount_moderate.wlz
18905_wholemount_weak.wlz
18905_wholemount_possible.wlz
18905_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18905_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17
thalamus mantle layer
strong strong
regionalstrong expression: see section 08 09 14 15
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
medulla oblongata alar plate mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17
rest of cerebellum mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
pons mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 07 18
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 17 18 19 20
ventral grey horn
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15
dorsal root ganglion
strong strong
regionalstrong expression: see section 09 10 11 moderate expression: see section 08 12 16 17
anterior naris epithelium
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16
external naris epithelium
moderate moderate
regionalmoderate expression: see section 15 16
nasal cavity epithelium
moderate moderate
regionalmoderate expression: see section 15
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 14 16 17
aorta
strong strong
regionalstrong expression: see section 10 11 12 13
stomach
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 moderate expression: see section 02 03 04
midgut
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17 18
bladder
moderate moderate
regionalmoderate expression: see section 12 13 14 15 16
left lung
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14
right lung
strong strong
regionalstrong expression: see section 14 15 16 17 18 19 20 21 22 23
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2457
Entity Detected:Cobl, cordon-bleu ( MGI:105056)
Sequence:sense strand is shown

>T2457
TGGCCTCGAGNCAGATTCGGACGAGGGCTATGGGCACAAGGAATTATGCCCTAAGTTGATTTTTGGATCT
TTGAGACTTTGACCACATACACATGGTTAAAATCACTTATGATCCTTTGAATTCTAGGTGTACAAAAACA
TAAATCAACAGAAATAGTCAGAATCTATTACATGCTCCAGGATGCTGCTTCTGGAGTAAGAAGCACCATG
GAGGAAGGCTGCTGAGATGACTTTTGCAGGATAAGAAAGCGTCAGATTCGTATTTGTATTCCTCACACAG
TGAAGCCTCACACCTCACAGATGATCTTGGACTGTGATCTGACCAACTAGCTTTTAAAATTCCACTGTTG
CTGCCCAGAATAGCAGCCCTACTTGACCCTCTGAGCAAGACATTCCTGGCTCCTTAGAAGATGATGGGAA
GCAGAGATGAGAACACTGGAAGGGTTGTCCGTTTTCTGTATAGATGTGTCCCACTTGTATAGTTTCCCCC
CTCCCCCATCCCCAGTGTCCCAGAAGGCTATGACATGCATCAGGTTACTGTGAAGGAG
Notes:The probe template was PCR amplified from IMAGE:1247884 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1247884 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18908 same embryo
 EMAGE:18909 same embryo
 EMAGE:18906 same embryo
 EMAGE:18907 same embryo
 EurExpress:euxassay_014151 same experiment
 MGI:4823967 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS