Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18928

Vps33b vacuolar protein sorting 33B (yeast) ( MGI:2446237)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18928 EMAGE:18928 EMAGE:18928 EMAGE:18928 EMAGE:18928
"Pseudo-wholemount" of euxassay_014236. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_014236_01 euxassay_014236_02 euxassay_014236_03 euxassay_014236_04
EMAGE:18928 EMAGE:18928 EMAGE:18928 EMAGE:18928 EMAGE:18928
euxassay_014236_05 euxassay_014236_06 euxassay_014236_07 euxassay_014236_08 euxassay_014236_09
EMAGE:18928 EMAGE:18928 EMAGE:18928 EMAGE:18928 EMAGE:18928
euxassay_014236_10 euxassay_014236_11 euxassay_014236_12 euxassay_014236_13 euxassay_014236_14
EMAGE:18928 EMAGE:18928 EMAGE:18928 EMAGE:18928 EMAGE:18928
euxassay_014236_15 euxassay_014236_16 euxassay_014236_17 euxassay_014236_18 euxassay_014236_19
EMAGE:18928 EMAGE:18928
euxassay_014236_20 euxassay_014236_21

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18928Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18928_wholemount_moderate.wlz
18928_wholemount_weak.wlz
18928_wholemount_possible.wlz
18928_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18928_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
facial vii ganglion
weak weak
regionalweak expression: see section 03 04 05 18 19
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 16
trigeminal v ganglion
weak weak
regionalweak expression: see section 02 03 04 05 06 07 16 17 18 19 20
vestibulocochlear viii ganglion
weak weak
regionalweak expression: see section 16 17
dorsal root ganglion
weak weak
regionalweak expression: see section 06 07 08 09 10 14 15 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2435
Entity Detected:Vps33b, vacuolar protein sorting 33B (yeast) ( MGI:2446237)
Sequence:sense strand is shown

>T2435
TGGCCTCGAGCCAGATTCGGAGGAGGCGGCACGAGGGCTACTCAACGCTGAGGACAAGGTGTTCAGTGAG
ATCCGCAATGAGCACTTCTCCAATGTCTTTGGCTTCTTGAGCCAGAAGGCCCGGAACTTGCAGGCCCAAT
ATGACCGCTGGAGAGGCATGGACATAAAGCAGATGAAGAACTTCGTGTCGCAAGAGCTCAAGGGACTGAA
GCAGGAGCACCGCCTTCTGAGTCTCCATATTGGGGCTTGTGAATCAATCATGAAGAAGAAAACCAAGCAG
GACTTCCAGGAGCTAATCAAGACCGAGCATGCGCTGCTGGAGGGCTTCAACATCCGAGAGAGCACTAGCT
ACATTGAAGAGCACATAGACCGGCAGGTGTCGCCCATAGAGAGCCTACGCCTCATGTGCCTTTTGTCCAT
CACTGAGAATGGTTTGATACCCAAGGATTATCGGTCCCTGAAAACACAGTATCTGCAGAGCTATGGCCCC
GAGCACCTGCTAACCTTCTCCAACCTGCGGAGAGCCGGGCTTCTAACAGAGCA
Notes:The probe template was PCR amplified from IMAGE:1245330 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1245330 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18931 same embryo
 EMAGE:18930 same embryo
 EMAGE:18929 same embryo
 EMAGE:18932 same embryo
 EurExpress:euxassay_014236 same experiment
 MGI:4829171 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS