Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18946

Mirg miRNA containing gene ( MGI:3781106)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18946 EMAGE:18946 EMAGE:18946 EMAGE:18946 EMAGE:18946
"Pseudo-wholemount" of euxassay_014257. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_014257_01 euxassay_014257_02 euxassay_014257_03 euxassay_014257_04
EMAGE:18946 EMAGE:18946 EMAGE:18946 EMAGE:18946 EMAGE:18946
euxassay_014257_05 euxassay_014257_06 euxassay_014257_07 euxassay_014257_08 euxassay_014257_09
EMAGE:18946 EMAGE:18946 EMAGE:18946 EMAGE:18946 EMAGE:18946
euxassay_014257_10 euxassay_014257_11 euxassay_014257_12 euxassay_014257_13 euxassay_014257_14
EMAGE:18946 EMAGE:18946 EMAGE:18946 EMAGE:18946 EMAGE:18946
euxassay_014257_15 euxassay_014257_16 euxassay_014257_17 euxassay_014257_18 euxassay_014257_19
EMAGE:18946 EMAGE:18946 EMAGE:18946 EMAGE:18946 EMAGE:18946
euxassay_014257_20 euxassay_014257_21 euxassay_014257_22 euxassay_014257_23 euxassay_014257_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18946Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18946_wholemount_strong.wlz
18946_wholemount_moderate.wlz
18946_wholemount_weak.wlz
18946_wholemount_possible.wlz
18946_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18946_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
upper arm muscle
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 20 21 22 23 24
upper leg muscle
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 20 21 22 23
diaphragm
moderate moderate
regionalmoderate expression: see section 02 03 04 05 18 19 20 21 22 23 24 weak expression: see section 01 06 07 17
forearm rest of mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02
foot mesenchyme
moderate moderate
regionalmoderate expression: see section 05 06 20 21
lower leg rest of mesenchyme
moderate moderate
regionalmoderate expression: see section 03
vertebral axis musculature
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
metencephalon floor plate
weak weak
regionalweak expression: see section 11 12
pons mantle layer
weak weak
regionalweak expression: see section 07 17
midbrain floor plate
weak weak
regionalweak expression: see section 10 11 12
midbrain mantle layer
weak weak
regionalweak expression: see section 09 10 11 12
facial vii ganglion
moderate moderate
single cellmoderate expression: see section 05 19 20
trigeminal v ganglion
moderate moderate
single cellmoderate expression: see section 02 03 04 05 06 07 08 17 18 19 20 21
ventral grey horn
weak weak
regionalweak expression: see section 08 09 10 11 12 13 14
extrinsic ocular muscle
moderate moderate
regionalmoderate expression: see section 04 05 06 07 17 18 19 20 21 weak expression: see section 02 03 22 23
tongue muscle
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15
tail mesenchyme
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T39799
Entity Detected:Mirg, miRNA containing gene ( MGI:3781106)
Sequence:sense strand is shown

>T39799
TGGGTACTTGAGGAGAGGTTGTCTGTGATGAGTTCGCTTTATTAATGACGAATATAACACAGATGGCCTG
TTTTCAATACCACCTGCCACTCCGGTCACTCGGCAGTACATACCAGGTGTCACACCACTGCCCGGCAGGT
GACAACGCTGAATTGGTCCTCAGGAGCGGATGTTCAAGGAACCCTGCCTATGCACCATGCTAGCTGCCAG
TCCTAGGTTGGGACATTCCACTGGGGACATCCATGGGAGAGCTATGGCCATTAACAAGTCCTGAGCCCTG
ACCTGAAGCCATCAGTGGCCTAGCTGCTCTACCTGACTTTGTGGCCTCCCTTCCTGGATCTCTCGCTTAC
GACAACCGACAACAAAGATGTTTGACTCCAGAAGATGCTCCCCGCGGCCCACCTGAGAGGACTGTCCACA
CCC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 161032. Forward Primer - name:161032_F_cDNA_mCG146212, sequence:TGGGTACTTGAGGAGAGGTTGT; Reverse Primer - name:161032_N_SP6_cDNA_mCG146212, sequence:GGGTGTGGACAGTCCTCTCAG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18950 same embryo
 EMAGE:18949 same embryo
 EMAGE:18947 same embryo
 EMAGE:18948 same embryo
 EurExpress:euxassay_014257 same experiment
 MGI:4826383 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS