Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19071

Lmnb1 lamin B1 ( MGI:96795)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19071 EMAGE:19071 EMAGE:19071 EMAGE:19071 EMAGE:19071
"Pseudo-wholemount" of euxassay_015910. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_015910_01 euxassay_015910_02 euxassay_015910_03 euxassay_015910_04
EMAGE:19071 EMAGE:19071 EMAGE:19071 EMAGE:19071 EMAGE:19071
euxassay_015910_05 euxassay_015910_06 euxassay_015910_07 euxassay_015910_08 euxassay_015910_09
EMAGE:19071 EMAGE:19071 EMAGE:19071 EMAGE:19071 EMAGE:19071
euxassay_015910_10 euxassay_015910_11 euxassay_015910_12 euxassay_015910_13 euxassay_015910_14
EMAGE:19071 EMAGE:19071 EMAGE:19071 EMAGE:19071 EMAGE:19071
euxassay_015910_15 euxassay_015910_16 euxassay_015910_17 euxassay_015910_18 euxassay_015910_19
EMAGE:19071
euxassay_015910_20

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19071Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19071_wholemount_strong.wlz
19071_wholemount_moderate.wlz
19071_wholemount_weak.wlz
19071_wholemount_possible.wlz
19071_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19071_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
vertebral axis musculature
moderate moderate
regionalmoderate expression: see section 01 02 17 18 weak expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 19 20
thymus primordium
moderate moderate
regionalmoderate expression: see section 08 10 11
sublingual gland primordium
moderate moderate
regionalmoderate expression: see section 05 12 13 14
thyroid gland
weak weak
regionalweak expression: see section 07 10 11 12
hypothalamus ventricular layer
strong strong
regionalstrong expression: see section 10 11 12 13 moderate expression: see section 09
diencephalon lateral wall ventricular layer
strong strong
regionalstrong expression: see section 10 11 12 moderate expression: see section 09
olfactory cortex ventricular layer
strong strong
homogeneousstrong expression: see section 09 10 14
telencephalon ventricular layer
strong strong
homogeneousstrong expression: see section 02 03 04 05 06 09 10 11 14 15 16 17 18 19 20 moderate expression: see section 01 07 08
rest of cerebellum marginal layer
moderate moderate
regionalmoderate expression: see section 03 04 05 17 18 weak expression: see section 06 07 08 09 11 12 13 14 15 16
midbrain ventricular layer
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 08 12 weak expression: see section 11
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 08 12 weak expression: see section 09 11
metanephros
moderate moderate
regionalmoderate expression: see section 05 06 07 08 13 14 15 16
lung
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 weak expression: see section 14 15 16 17 18
trachea
moderate moderate
regionalmoderate expression: see section 09 10
axial skeleton
moderate moderate
regionalmoderate expression: see section 10 weak expression: see section 09 11 12
axial skeleton tail region
moderate moderate
regionalmoderate expression: see section 09 10 weak expression: see section 07 08
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T63313
Entity Detected:Lmnb1, lamin B1 ( MGI:96795)
Sequence:sense strand is shown

>T63313
CTTGAGAATGCCAGACTCTCCTCAGAGATGAACACTTCCACTGTCAACAGTGCCCGGGAAGAGCTGATGG
AGAGCCGGATGAGGATCGAGAGCCTCTCCTCACAGCTCTCTAACCTGCAGAAAGAGTCTAGAGCGTGTTT
GGAAAGGATCCAGGAATTGGAGGACATGCTTGCTAAGGAGAGAGACAACTCGCGCCGCATGCTGTCTGAC
AGAGAGAGAGAGATGGCGGAGATCAGGGACCAGATGCAGCAGCAGCTGAGTGATTATGAGCAGCTGCTGG
ACGTGAAGCTGGCCCTGGACATGGAGATCAGCGCCTACAGGAAGCTCCTGGAAGGCGAAGAAGAGCGGTT
AAAGCTCTCTCCAAGCCCTTCTTCCCGGGTGACCGTGTCCAGAGCGTCCTCCAGTCGCAGTGTGCGCACC
ACCAGAGGAAAGCGGAAGAGAGTTGATGTGGAGGAGTCGGAGGCGAGCAGCAGTGTTAGCATTTCCCACT
CTGCCTCAGCCACGGGGAACGTGTGCATTGAAGAGATAGATGTTGATGGGAAGTTTATTCGCTTGAAGAA
CACTTCTGAGCAGGATCAACCAATGGGAGGCTGGGAGATGATCAGAAAAATTGGAGACACATCAGTCAGT
TACAAATATACCTCAAGATATGTGCTGAAGGCTGGCCAGACTGTCACAGTGTGGGCTGCAAATGCTGGCG
TCACAGCCAGCCCTCCAACTGACCTCATCTGGAAGAACCAG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 99219. Forward Primer - name:099219_F_cDNA_Lmnb1, sequence:CTTGAGAATGCCAGACTCTCCT; Reverse Primer - name:099219_N_SP6_cDNA_Lmnb1, sequence:CTGGTTCTTCCAGATGAGGTC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19073 same embryo
 EMAGE:19069 same embryo
 EMAGE:19070 same embryo
 EMAGE:19068 same embryo
 EMAGE:19072 same embryo
 EurExpress:euxassay_015910 same experiment
 MGI:4825947 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS