EMAGE mouse gene expression spatial database

EMAGE:19134

Mir27a microRNA 27a ( MGI:2676902)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


"Pseudo-wholemount" of euxassay_019420. This image has been made by aligning and collapsing the constitutent sections. Information about the method.	euxassay_019420_01	euxassay_019420_02	euxassay_019420_03	euxassay_019420_04

euxassay_019420_05	euxassay_019420_06	euxassay_019420_07	euxassay_019420_08	euxassay_019420_09

euxassay_019420_10	euxassay_019420_11	euxassay_019420_12	euxassay_019420_13	euxassay_019420_14

euxassay_019420_15	euxassay_019420_16	euxassay_019420_17	euxassay_019420_18	euxassay_019420_19

euxassay_019420_20	euxassay_019420_21	euxassay_019420_22	euxassay_019420_23	euxassay_019420_24

View assay images:
Expression pattern clarity:
Find spatially similar wholemount expression patterns:

Expression Pattern Description

Spatial Annotation:

Annotation colour key:

wholemount mapping

Download individual expression domains:

Download all expression domains:

Find spatially similar wholemount expression patterns:

Morphological match to the template:

Annotation Validation:

spatial mapping by EMAGE editor

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T70357
Entity Detected:	Mir27a, microRNA 27a ( MGI:2676902)
Sequence:	sense strand is shown >T70357 TTCACAGTGGCTAAGTTCCGC
Notes:	The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-27a was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:	LNA
Strand:	antisense
Label:	digoxigenin

Specimen

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EMAGE:19136 same embryo
	EMAGE:19137 same embryo
	EMAGE:19139 same embryo
	EMAGE:19140 same embryo
	EMAGE:19135 same embryo
	EMAGE:19138 same embryo
	EMAGE:19133 same embryo
	EurExpress:euxassay_019420 same experiment
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source