EMAGE mouse gene expression spatial database

EMAGE:19138

Mir26b microRNA 26b ( MGI:2676901)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


"Pseudo-wholemount" of euxassay_019404. This image has been made by aligning and collapsing the constitutent sections. Information about the method.	euxassay_019404_01	euxassay_019404_02	euxassay_019404_03	euxassay_019404_04

euxassay_019404_05	euxassay_019404_06	euxassay_019404_07	euxassay_019404_08	euxassay_019404_09

euxassay_019404_10	euxassay_019404_11	euxassay_019404_12	euxassay_019404_13	euxassay_019404_14

euxassay_019404_15	euxassay_019404_16	euxassay_019404_17	euxassay_019404_18	euxassay_019404_19

euxassay_019404_20	euxassay_019404_21	euxassay_019404_22	euxassay_019404_23	euxassay_019404_24

View assay images:
Expression pattern clarity:
Find spatially similar wholemount expression patterns:

Expression Pattern Description

Spatial Annotation:

Annotation colour key:

wholemount mapping

Download individual expression domains:

Download all expression domains:

Find spatially similar wholemount expression patterns:

Morphological match to the template:

Text Annotation:

Structure

Level

Pattern

Notes

nasal cavity olfactory epithelium

weak

regional

weak expression: see section 10 11 12 13

Annotation Validation:

spatial mapping by EMAGE editor, text annotation by author

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T70356
Entity Detected:	Mir26b, microRNA 26b ( MGI:2676901)
Sequence:	sense strand is shown >T70356 TTCAAGTAATTCAGGATAGGT
Notes:	The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-26b was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:	LNA
Strand:	antisense
Label:	digoxigenin

Specimen

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EMAGE:19136 same embryo
	EMAGE:19137 same embryo
	EMAGE:19139 same embryo
	EMAGE:19140 same embryo
	EMAGE:19135 same embryo
	EMAGE:19134 same embryo
	EMAGE:19133 same embryo
	EurExpress:euxassay_019404 same experiment
	MGI:4826250 same experiment
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source