Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19414

Ctgf connective tissue growth factor ( MGI:95537)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19414 EMAGE:19414 EMAGE:19414 EMAGE:19414 EMAGE:19414
"Pseudo-wholemount" of euxassay_004838. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_004838_01 euxassay_004838_02 euxassay_004838_03 euxassay_004838_04
EMAGE:19414 EMAGE:19414 EMAGE:19414 EMAGE:19414 EMAGE:19414
euxassay_004838_05 euxassay_004838_06 euxassay_004838_07 euxassay_004838_08 euxassay_004838_09
EMAGE:19414 EMAGE:19414 EMAGE:19414 EMAGE:19414 EMAGE:19414
euxassay_004838_10 euxassay_004838_11 euxassay_004838_12 euxassay_004838_13 euxassay_004838_14
EMAGE:19414 EMAGE:19414 EMAGE:19414 EMAGE:19414 EMAGE:19414
euxassay_004838_15 euxassay_004838_16 euxassay_004838_17 euxassay_004838_18 euxassay_004838_19
EMAGE:19414 EMAGE:19414 EMAGE:19414
euxassay_004838_20 euxassay_004838_21 euxassay_004838_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19414Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19414_wholemount_strong.wlz
19414_wholemount_moderate.wlz
19414_wholemount_weak.wlz
19414_wholemount_possible.wlz
19414_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19414_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 11 12 14 15 16 17 18 19 20 21
humerus
moderate moderate
regionalmoderate expression: see section 03 16 weak expression: see section 01 02 17 18 19 20
forelimb digit 1 phalanx
strong strong
regionalstrong expression: see section 02 18 19
forelimb digit 2 phalanx
strong strong
regionalstrong expression: see section 02 18 19
hand mesenchyme
strong strong
regionalstrong expression: see section 01 20 21
hindlimb digit 1 metatarsal
strong strong
regionalstrong expression: see section 17 18
hindlimb digit 1 phalanx
strong strong
regionalstrong expression: see section 02 17
hindlimb digit 2 mesenchyme
strong strong
regionalstrong expression: see section 01
hindlimb digit 2 metatarsal
strong strong
regionalstrong expression: see section 02 17 18
hindlimb digit 2 phalanx
strong strong
regionalstrong expression: see section 02 03 17 18
hindlimb digit 3 mesenchyme
strong strong
regionalstrong expression: see section 01
hindlimb digit 3 metatarsal
strong strong
regionalstrong expression: see section 02 17 18
hindlimb digit 3 phalanx
strong strong
regionalstrong expression: see section 02 03 04 17 18
hindlimb digit 4 mesenchyme
strong strong
regionalstrong expression: see section 01
hindlimb digit 4 metatarsal
strong strong
regionalstrong expression: see section 02 17 18
hindlimb digit 4 phalanx
strong strong
regionalstrong expression: see section 02 03 04 15 17 18
hindlimb digit 5 metatarsal
strong strong
regionalstrong expression: see section 17
hindlimb digit 5 phalanx
strong strong
regionalstrong expression: see section 03 04 05 15 17
foot mesenchyme
strong strong
regionalstrong expression: see section 01 18
fibula
moderate moderate
regionalmoderate expression: see section 19 weak expression: see section 20 21
tibia
moderate moderate
regionalmoderate expression: see section 19 weak expression: see section 20 21
adrenal cortex
weak weak
regionalweak expression: see section 06 07 13 14 15
diencephalon lateral wall ventricular layer
weak weak
regionalweak expression: see section 11 12
diencephalon meninges
weak weak
regionalweak expression: see section 07 08 09 10 11 12 13 14 15
telencephalon meninges
moderate moderate
regionalmoderate expression: see section 16 17 18 19 20 21 22 weak expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15
telencephalon ventricular layer
weak weak
regionalweak expression: see section 03 04 05 06 07 16 17 18 19 20
hindbrain meninges
moderate moderate
regionalmoderate expression: see section 16 17 18 weak expression: see section 04 05 06 07 08 09 10 11 12 13 14 15
rest of cerebellum ventricular layer
weak weak
regionalweak expression: see section 03 04 05 06 07 16 17 18 19
pons ventricular layer
weak weak
regionalweak expression: see section 07 08 09 13 14
midbrain meninges
moderate moderate
regionalmoderate expression: see section 16 17 18 weak expression: see section 06 07 08 09 10 11 12 13 14 15
midbrain ventricular layer
weak weak
regionalweak expression: see section 12
spinal cord ventricular layer
moderate moderate
single cellmoderate expression: see section 08 09 10 11 12
spinal cord meninges
weak weak
regionalweak expression: see section 07 08 09 10 11 12 13
otic capsule
strong strong
regionalstrong expression: see section 05 06 07 08 13 14 15
pharyngo-tympanic tube
strong strong
regionalstrong expression: see section 01 18 21 22 moderate expression: see section 19 20
tubotympanic recess
strong strong
regionalstrong expression: see section 01 02 03 17 18 19 20
nasal septum
strong strong
regionalstrong expression: see section 11 12
viscerocranium
strong strong
regionalExpression in the turbinate bone.
vomeronasal organ
strong strong
regionalstrong expression: see section 11 12
aorta
strong strong
regionalstrong expression: see section 08 09 10 11
heart ventricle
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 weak expression: see section 12 13 14
tongue muscle
moderate moderate
regionalmoderate expression: see section 08 09 10 11
midgut
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 08 09 10
lower jaw molar
weak weak
regionalweak expression: see section 05 14 15
palatal shelf
moderate moderate
regionalmoderate expression: see section 10 11 weak expression: see section 09
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 08 09
upper jaw molar
weak weak
regionalweak expression: see section 05 14 15
bladder
weak weak
regionalweak expression: see section 09 10 11 12
metanephros
weak weak
regionalweak expression: see section 06 07 13 14 15
cricoid cartilage
strong strong
regionalstrong expression: see section 09 11 12
laryngeal cartilage
strong strong
regionalstrong expression: see section 08
thyroid cartilage
strong strong
regionalstrong expression: see section 09 10 11
lung
weak weak
regionalweak expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16
trachea
strong strong
regionalstrong expression: see section 10 11
axial skeleton
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 weak expression: see section 07
basioccipital bone
strong strong
regionalstrong expression: see section 04 16
basisphenoid bone
strong strong
regionalstrong expression: see section 04
exoccipital bone
strong strong
regionalstrong expression: see section 02 03 04 05 06 16 17 18 19 20 21
temporal bone
strong strong
regionalstrong expression: see section 01 02
temporal bone petrous part
strong strong
regionalstrong expression: see section 02 03 04 16 17 18 19 20 21
vault of skull
strong strong
regionalstrong expression: see section 02
orbito-sphenoid
strong strong
regionalstrong expression: see section 05 06 07 09 10 11 12 15 16 17
clavicle
moderate moderate
regionalmoderate expression: see section 07 08 12
scapula
weak weak
regionalweak expression: see section 01 02 16 18 19 20
sternum
strong strong
regionalstrong expression: see section 09 10 11
pelvic girdle skeleton
strong strong
regionalstrong expression: see section 07 13 14 moderate expression: see section 08
axial skeleton tail region
strong strong
regionalstrong expression: see section 11 12
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T6501
Entity Detected:Ctgf, connective tissue growth factor ( MGI:95537)
Sequence:sense strand is shown

>T6501
GAAGACTCAGCCAGATCCACTCCAGCTCCGACCCCAGGAGACCGACCTCCTCCAGACGGCAGCAGCCCCA
GCCCAGCCGACAACCCCAGACGCCACCGCCTGGAGCGTCCAGACACCAACCTCCGCCCCTGTCCGAATCC
AGGCTCCGGCCGCGCCTCTCGTCGCCTCTGCACCCTGCTGTGCATCCTCCTACCGCGTCCCGATCATGCT
CGCCTCCGTCGCAGGTCCCATCAGCCTCGCCTTGGTGCTCCTCGCCCTCTGCACCCGGCCTGCTACGGGC
CAGGACTGCAGCGCGCAATGTCAGTGCGCAGCCGAAGCAGCGCCGCACTGCCCCGCCGGCGTGAGCCTGG
TGCTGGACGGCTGCGGCTGCTGCCGCGTCTGCGCCAAGCAGCTGGGAGAACTGTGTACGGAGCGTGACCC
CTGCGACCCACACAAGGGCCTCTTCTGCGATTTCGGCTCCCCCGCCAACCGCAAGATCGGAGTGTGCACT
GCCAAAGATGGTGCACCCTGTGTCTTCGGTGGGTCGGTGTACCGCAGCGGTGAGTCCTTCCAAAGCAGCT
GCAAATACCAATGCACTTGCCTGGATGGGGCCGTGGGCTGCGTGCCCCTGTGCAGCATGGACGTGCGCCT
GCCCAGCCCTGACTGCCCCTTCCCGAGAAGGGTCAAGCTGCCTGGGAAATGCTGCGAGGAGTGGGTGTGT
GACGAGCCCAAGGACCGCACAGCAGTTGGCCCTGCCCTAGCTGCCTACCGACTGGAAGACACATTTGGCC
CAGACCCAACTATGATGCGAGCCAACTGCCTGGTCCAGACCACAGAGTGGAGCGCCTGTTCTAAGACCTG
TGGGATGGGCATCTCCACCCGAGTTACCAATGACAATACCTTCTGCAGACTTGAGAAGCAGAGTCGCCTC
TGCATGGTCAGGCCCTGCGAAGCTGACCTGGAGGAAAACATTAAGAAGGGCAAAAAGTGCATCCGGACAC
CTAAAATCGCCAAGCCTGTCAAGTTTGAGCTTTCTGGCTGCACCAGTGTGAAGACATACAGGGCTAAGTT
CTGCGGGGTGTGCACAGACGGCCGCTGCTGCACACCGCACAGAACCACCACTCTGCCAGTGGAGTTCAAA
TGCCCCGATGGCGAGATCATGAAAAAGAATATGATGTTCATCAAGACCTGTGCCTGCCATTACAACTGTC
CTGGGGACAATGACATCTTTGAGTCCCTGTACTACAGGAAGATGTACGGAGACATGGCGTAAAGCCAGGA
AGTAAGGGACACGAACTCATTAGACTATAACTTGAACTGAGTTGCATCTCATTTTCTTCTGTAAAAACAA
TTACAGTAGCACATTAATTTAAATCTGTGTTTTTAACTACCGTGGGAGGAACTATCCCACCAAAGTGAGA
ACGTTATGTCATGGCCATACAAGTAGTCTGTCAACCTCAGACACTGGTTTCGAGACAGTTTACACTTGAC
AGTTGTTCATTAGCGCACAGTGCCAGAACGCACACTGAGGTGAGTCTCCTGGAACAGTGGAGATGCCAGG
AGAAAGAAAGACAGGTACTAGCTGAGGTTATTTTAAAAGCAGCAGTGTGCCTACTTTTTGGAGTGTAACC
GGGGAGGGCAATTATAGCATGCTTGCAGACAGACCTGCTCTAGCGAGAGCTGAGCATGTGTCCTCCACTA
GATGAGGCTGAGTCCAGCTGTTCTTTAAGAACAGCAGTTTCAGCTCTGACCATTCTGATTCCAGTGACAC
TTGTCAGGAGTCAGAGCCTTGTCTGTTAGACTGGACAGCTTGTGGCAAGTAAGTTTGCCTGTAACAAGCC
AGATTTTTATTGATATTGTAAATATTGTGGATATATATATATATATATTTGTACAGTTATCTAAGTTAAT
TTAAAGTCATTTGTTTTTGTTTTAAGTGCTTTTGGGATTTTAAACTGATAGCCTCAAACTCCAAACACCA
TAGGTAGGACACGAAGCTTATCTGTGATTCAAAACAAAGGAGATACTGCAGTGGGAATTGTGACCTGAGT
GACTCTCTGTCAGAACAAATGCTGTGCAGGTGATAAAGCTATGTATTGGAAGTCAGATTTCTAGTAGGAA
ATGTGGTCAAATCCCTGTTGGTGAACAAATGGCCTTTATTAAGAAATGGCTGGCTCAGGGTAAGGTCCGA
TTCCTACCAGGAAGTGCTTGCTGCTTCTTTGATTATGACTGGTTTGGGGTGGGGGGCAGTTTATTTGTTG
AGAGTGTGACCAAAAGTTACATGTTTGCACCTTTCTAGTTGAAAATAAAGTATATATATATTTTTTATAT
GAAAAAAAAAAAAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:3589136 using vector (pCMV-SPORT6) specific primers. Forward Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the probe sequence indicated here was given by the EURExpress Consortium and has been checked using a computational method whereby a BLAST comparison was made against the full insert sequence of IMAGE:3589136 which was retrieved directly from NCBI.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19418 same embryo
 EMAGE:19413 same embryo
 EMAGE:19415 same embryo
 EMAGE:19416 same embryo
 EMAGE:19417 same embryo
 EurExpress:euxassay_004838 same experiment
 MGI:4824101 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS