Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19801

Cachd1 cache domain containing 1 ( MGI:2444177)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19801 EMAGE:19801 EMAGE:19801 EMAGE:19801 EMAGE:19801
"Pseudo-wholemount" of euxassay_006310. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_006310_01 euxassay_006310_02 euxassay_006310_03 euxassay_006310_04
EMAGE:19801 EMAGE:19801 EMAGE:19801 EMAGE:19801 EMAGE:19801
euxassay_006310_05 euxassay_006310_06 euxassay_006310_07 euxassay_006310_08 euxassay_006310_09
EMAGE:19801 EMAGE:19801 EMAGE:19801 EMAGE:19801 EMAGE:19801
euxassay_006310_10 euxassay_006310_11 euxassay_006310_12 euxassay_006310_13 euxassay_006310_14
EMAGE:19801 EMAGE:19801 EMAGE:19801 EMAGE:19801 EMAGE:19801
euxassay_006310_15 euxassay_006310_16 euxassay_006310_17 euxassay_006310_18 euxassay_006310_19
EMAGE:19801 EMAGE:19801 EMAGE:19801 EMAGE:19801 EMAGE:19801
euxassay_006310_20 euxassay_006310_21 euxassay_006310_22 euxassay_006310_23 euxassay_006310_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19801Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19801_wholemount_strong.wlz
19801_wholemount_moderate.wlz
19801_wholemount_weak.wlz
19801_wholemount_possible.wlz
19801_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19801_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall mantle layer
strong strong
regionalstrong expression: see section 13 14 moderate expression: see section 06 07 08 09 10 11 12 15 16 17
cerebral cortex ventricular layer
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 13 14 15 16 17 18 19 20 moderate expression: see section 02 11 12 21 22
medulla oblongata basal plate ventricular layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15
rest of cerebellum ventricular layer
strong strong
regionalstrong expression: see section 03 05 06 19 20 21 moderate expression: see section 07 08 09 10 11 12 13 14 15 16 17 18
pons ventricular layer
strong strong
regionalstrong expression: see section 04 05 06 19 20 moderate expression: see section 07 08 09 10 11 12 13 14 15 16 17 18
midbrain mantle layer
strong strong
regionalstrong expression: see section 13 14 moderate expression: see section 06 07 08 09 10 11 12 15 16 17
midbrain ventricular layer
strong strong
regionalstrong expression: see section 10 11 13 14 moderate expression: see section 09 12 15
spinal cord ventricular layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12
naris
moderate moderate
regionalmoderate expression: see section 12 13 15 16 17
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 13 weak expression: see section 12 16
lower jaw molar
moderate moderate
regionalmoderate expression: see section 19 weak expression: see section 07
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 13 weak expression: see section 12 16
upper jaw molar
moderate moderate
regionalmoderate expression: see section 19 weak expression: see section 07
genital tubercle of male
moderate moderate
regionalmoderate expression: see section 10 11 13 weak expression: see section 12
lung
weak weak
regionalweak expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35003
Entity Detected:Cachd1, cache domain containing 1 ( MGI:2444177)
Sequence:sense strand is shown

>T35003
ACTGCTCTAAGTACCGCCTGACAAGGATCCCAGGAACCAACGCGTTTGTCGGCATCGTCAACGAGACCTG
CGACTCTCTTGCCTTCTGTGCTTGCAGCATGGTGGACCGTCTCTGTCTCAACTGCCACCGAATGGAGCAA
AATGAATGTGAATGTCCTTGTGAGTGCCCCCTGGAGGTCAATGAGTGTACTGGCAACCTCACCAATGCAG
AGAACAGAAACCCGAGCTGTGAGGTTCACCAGGAGCCAGTGACATACACGGCTATCGACCCAGGCCTGCA
AGATGCCCTGCAGCAGTGTGTCAACAGCAGATGTAACCAGAGGATGGAAAGTGGGGACTGTTTCGGTGTG
CTGGACTGCGAATGGTGTGTGGTGGACAGTGATGGAAAGACTCACCTGGACAAATCCTACTGTGCGCCCC
AGAAAGAATGCTTCGGGGGGATCGTGGGAGCCAAAAGTCCCTATGTTGATGACATGGGAGCCATCGGTGA
TGAGGTGATCACACTAAACATGATTAAGAGTGCTCCGGTGGGCCCTGTGGCCGGAGGCATCATGGGCTGC
ATCATGGTGCTGGTCCTTGCCGTGTATGCTTACCGCCACCAGATCCATCGCCGCAGCCACCAGCACATGT
CACCTCTTGCTGCTCAAGAAATGTCAGTGCGTATGTCCAACCTGGAGAATGACAGAGATGAAAGAGACGA
TGACAGTCATGAAGACAGAGGCATCATCAGCAACACCCGGTTCATAGCTGCAGTCATGGAGCGACACGTA
CACAGTCCAGAAAGGAGGC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 50025. Forward Primer - name:050025_F_cDNA_B430218L07Rik, sequence:ACTGCTCTAAGTACCGCCTGAC; Reverse Primer - name:050025_N_SP6_cDNA_B430218L07Rik, sequence:GCCTCCTTTCTGGACTGTGTA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19804 same embryo
 EMAGE:19802 same embryo
 EMAGE:19805 same embryo
 EMAGE:19800 same embryo
 EMAGE:19803 same embryo
 EurExpress:euxassay_006310 same experiment
 MGI:4823572 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS