Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19943

Myh10 myosin, heavy polypeptide 10, non-muscle ( MGI:1930780)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19943 EMAGE:19943 EMAGE:19943 EMAGE:19943 EMAGE:19943
"Pseudo-wholemount" of euxassay_009369. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009369_01 euxassay_009369_02 euxassay_009369_03 euxassay_009369_04
EMAGE:19943 EMAGE:19943 EMAGE:19943 EMAGE:19943 EMAGE:19943
euxassay_009369_05 euxassay_009369_06 euxassay_009369_07 euxassay_009369_08 euxassay_009369_09
EMAGE:19943 EMAGE:19943 EMAGE:19943 EMAGE:19943 EMAGE:19943
euxassay_009369_10 euxassay_009369_11 euxassay_009369_12 euxassay_009369_13 euxassay_009369_14
EMAGE:19943 EMAGE:19943 EMAGE:19943 EMAGE:19943 EMAGE:19943
euxassay_009369_15 euxassay_009369_16 euxassay_009369_17 euxassay_009369_18 euxassay_009369_19
EMAGE:19943 EMAGE:19943 EMAGE:19943
euxassay_009369_20 euxassay_009369_22 euxassay_009369_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19943Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19943_wholemount_strong.wlz
19943_wholemount_moderate.wlz
19943_wholemount_weak.wlz
19943_wholemount_possible.wlz
19943_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19943_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
body cavity or lining
weak weak
spottedweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 22 23
limb
weak weak
spottedweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 22 23
mesenchyme
weak weak
spottedweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 22 23
vertebral axis musculature
weak weak
spottedweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 22 23
gland
weak weak
spottedweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 22 23
alimentary system
weak weak
spottedweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 22 23
nervous system
weak weak
spottedweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 22 23
integumental system
weak weak
spottedweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 22 23
sensory organ system
weak weak
spottedweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 22 23
cardiovascular system
weak weak
spottedweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 22 23
urinary system
weak weak
spottedweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 22 23
reproductive system
weak weak
spottedweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 22 23
respiratory system
weak weak
spottedweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 22 23
skeleton
weak weak
spottedweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 22 23
tail
weak weak
spottedweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 22 23
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36654
Entity Detected:Myh10, myosin, heavy polypeptide 10, non-muscle ( MGI:1930780)
Sequence:sense strand is shown

>T36654
CCTCCACAAGACATGCGTATTAAACAGATTGTCTCATCGTTGCATCTATTTTCCATGTATTCATCAAGAG
ACCATTTTATGACACATTAAGAAGAAAGAACCTTTTTGAAACAAACTCCAGGCCCTTTGTTGCCAGTGGC
TGGGCCTAAGGGTTGCCCCGGGACCGTGCTCAGCTGCTCTGCATGCCCTGTCCTACTGACAGGTACCTTA
GTTCTGTGTTCATGTGGCCCTGACCCTTCCTTCAACCACACCTGGTCTCTTAGAACATTGTGAACCTAAC
CTGCACTTGTGTCTCTCATTTCCTGTGAATAGTGATCACTGTCTCAGTGAGCAAACTGGGAGAGGGGCTT
TGGCGGCTTAGGGGTGGGTTTGGATTGGGGAAGCAGCATCCATTTGGGGTTCTCCTGCCCATCTCCCAAG
GGGTGACCCTGCCCCTCAAATTCATGGTGTCCCCACCGTCTCAATGTGAATAGTCTCAGAGCTCTGTGCA
CAGAGAGGACAGTGGCCACAACACATAAGGTGCCCCGGGTGGCAGCCATCACAGTAACTTCCAGGTGGTC
TCCTGAGTGTCTGGCTTGATAATGCCCTCAATTCAGGAGTGAGCCTCTGTGACCCTTGGGGTGCTCGCAG
AAGGCCTCTCCAAGCAGTCAAGCCCTCTTGCAAATTCAGCCACTGCTTTGAGCCCAAAACGGGAATATTA
GT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 93014. Forward Primer - name:093014_F_cDNA_Myh10, sequence:CCTCCACAAGACATGCGTATTA; Reverse Primer - name:093014_N_SP6_cDNA_Myh10, sequence:ACTAATATTCCCGTTTTGGGC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19945 same embryo
 EMAGE:19942 same embryo
 EMAGE:19944 same embryo
 EurExpress:euxassay_009369 same experiment
 MGI:4826540 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS