Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19956

Pard3b par-3 partitioning defective 3 homolog B (C. elegans) ( MGI:1919301)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19956 EMAGE:19956 EMAGE:19956 EMAGE:19956 EMAGE:19956
"Pseudo-wholemount" of euxassay_009412. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009412_01 euxassay_009412_02 euxassay_009412_03 euxassay_009412_04
EMAGE:19956 EMAGE:19956 EMAGE:19956 EMAGE:19956 EMAGE:19956
euxassay_009412_05 euxassay_009412_06 euxassay_009412_07 euxassay_009412_08 euxassay_009412_09
EMAGE:19956 EMAGE:19956 EMAGE:19956 EMAGE:19956 EMAGE:19956
euxassay_009412_10 euxassay_009412_11 euxassay_009412_12 euxassay_009412_13 euxassay_009412_14
EMAGE:19956 EMAGE:19956 EMAGE:19956 EMAGE:19956 EMAGE:19956
euxassay_009412_15 euxassay_009412_16 euxassay_009412_17 euxassay_009412_18 euxassay_009412_19

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19956Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19956_wholemount_strong.wlz
19956_wholemount_moderate.wlz
19956_wholemount_weak.wlz
19956_wholemount_possible.wlz
19956_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19956_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
hypothalamus ventricular layer
weak weak
regionalweak expression: see section 10 11 12 13 14
diencephalon lateral wall ventricular layer
weak weak
regionalweak expression: see section 10 11 12 13
telencephalon ventricular layer
weak weak
regionalweak expression: see section 01 02 03 04 05 06 08 09 10 11 13 14 15 16 17 18 19
medulla oblongata alar plate ventricular layer
weak weak
regionalweak expression: see section 07 08 09 10 14 15
medulla oblongata basal plate ventricular layer
weak weak
regionalweak expression: see section 11 12 13
rest of cerebellum ventricular layer
weak weak
regionalweak expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
pons ventricular layer
weak weak
regionalweak expression: see section 06 07 08 09 10 11 12 13 14 15 16
midbrain ventricular layer
weak weak
regionalweak expression: see section 06 07 08 09 10 11 12 13 14
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 11 14 weak expression: see section 10
vomeronasal organ
moderate moderate
regionalmoderate expression: see section 11 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36816
Entity Detected:Pard3b, par-3 partitioning defective 3 homolog B (C. elegans) ( MGI:1919301)
Sequence:sense strand is shown

>T36816
AGGGAGAGACAGTGTCATTGGTCATTGCCCGCCAGGAAGGGAGCTTCCTGCCCCGAGAGCTGAAAGGAGA
ACCTGATTGTTATGCTCTCTCCCTGGAGTCAAGCGAGCAGCTCACCTTGGAGATCCCCCTGAATGATTCT
GGCTCCGCTGGCCTGGGGGTTAGCCTGAAAGGGAATAAGTCTCGAGAAACTGGAACTGACTTGGGGATTT
TTATCAAATCCATCATCCATGGAGGTGCTGCTTTCAAGGATGGCCGTCTCCGAATGAATGACCAACTGAT
TGCTGTTAACGGGGAAACTCTTCTGGGAAAGTCCAACCACGAAGCCATGGAAACACTCAGGCGATCCATG
TCCATGGAGGGAAACATCCGGGGCATGATCCAGTTGGTGATTCTGAGGAGACCTGAGAGACCACTGGAGG
AGCTTTCAGAATGTGGAGCACTTTCCAGACCAGGCTTTGAGAACTGTCAAGAAGCTCTGAGCACCTCCAG
GCGAAATGATAGTAGTATATTATATCCGTTTGGCACCTATAGTCCACAAGATAAAAGGAAAGACCTATTG
CTTCCCAGTGATGGGTGGGCTGAGAATGAAGTACCACCGTCCCCGCCACCACATCCTGCTCTGGAATGGG
GCCTTGAAGATTTCAGTCACAGCTCTGGAGTGGATTCCACAGGATATTTTCCAGATCAACATGTCAACTT
CAGAACGGTGACACCAGTCAGGCAGCCCGAATTGATTAACCTTAAAGCCTCCAAGAGCATGGACCTTGTG
CCAGATGAAGGCAAAGTTCAGTCGCTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 75657. Forward Primer - name:075657_F_cDNA_2010002N16Rik, sequence:AGGGAGAGACAGTGTCATTGGT; Reverse Primer - name:075657_N_SP6_cDNA_2010002N16Rik, sequence:CAGCGACTGAACTTTGCCTTC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19957 same embryo
 EMAGE:19954 same embryo
 EMAGE:19953 same embryo
 EMAGE:19952 same embryo
 EMAGE:19955 same embryo
 EurExpress:euxassay_009412 same experiment
 MGI:4827050 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS