Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19977

Npas3 neuronal PAS domain protein 3 ( MGI:1351610)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19977 EMAGE:19977 EMAGE:19977 EMAGE:19977 EMAGE:19977
"Pseudo-wholemount" of euxassay_009424. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009424_01 euxassay_009424_02 euxassay_009424_03 euxassay_009424_04
EMAGE:19977 EMAGE:19977 EMAGE:19977 EMAGE:19977 EMAGE:19977
euxassay_009424_05 euxassay_009424_06 euxassay_009424_07 euxassay_009424_08 euxassay_009424_09
EMAGE:19977 EMAGE:19977 EMAGE:19977 EMAGE:19977 EMAGE:19977
euxassay_009424_10 euxassay_009424_11 euxassay_009424_12 euxassay_009424_13 euxassay_009424_14
EMAGE:19977 EMAGE:19977 EMAGE:19977 EMAGE:19977 EMAGE:19977
euxassay_009424_15 euxassay_009424_16 euxassay_009424_17 euxassay_009424_18 euxassay_009424_19
EMAGE:19977 EMAGE:19977 EMAGE:19977 EMAGE:19977
euxassay_009424_20 euxassay_009424_21 euxassay_009424_22 euxassay_009424_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19977Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19977_wholemount_strong.wlz
19977_wholemount_moderate.wlz
19977_wholemount_weak.wlz
19977_wholemount_possible.wlz
19977_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19977_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
hypothalamus mantle layer
weak weak
regionalweak expression: see section 09
hypothalamus ventricular layer
weak weak
regionalweak expression: see section 11 12 13
diencephalon lateral wall mantle layer
weak weak
regionalweak expression: see section 07 08 09 13 14 15 16
diencephalon lateral wall ventricular layer
weak weak
regionalweak expression: see section 11 12 13
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 01 02 weak expression: see section 03 04 05 06 07 15
medulla oblongata basal plate mantle layer
moderate moderate
single cellmoderate expression: see section 11 12 13 14 weak expression: see section 15
rest of cerebellum mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 10 14 15 weak expression: see section 06 07 16
pons mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 13 14 15 weak expression: see section 07 16 17 18
pons ventricular layer
moderate moderate
regionalmoderate expression: see section 10 12 13
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 10 13 14 15 16 weak expression: see section 07
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 12 13
ventral grey horn
moderate moderate
single cellmoderate expression: see section 12 13 14 weak expression: see section 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36838
Entity Detected:Npas3, neuronal PAS domain protein 3 ( MGI:1351610)
Sequence:sense strand is shown

>T36838
TCCTCTTCTCAGTCAGAGACCCCTGAGCCAGTGGAGACGACCAGCCCTAGTCTGCTAACCACGGACAACA
CCCTTGAACGGTCCTTTTTCATCCGAATGAAGTCTACTCTGACCAAACGTGGAGTCCACATCAAGTCATC
TGGGTATAAGGTGATTCACATAACAGGCCGGCTTCGCCTCAGAGTGCCGCTGTCCCACGGGAGGACCGTC
CCCAGCCAAATCATGGGTCTGGTGGTTGTGGCTCACGCCTTGCCTCCCCCTACGATCAATGAAGTCAGAA
TTGACTGCCATATGTTCGTCACTCGAGTAAACATGGATCTCAATATCATTTACTGTGAAAATAGGATTAG
TGATTACATGGATCTGACCCCTGTAGACATCGTAGGGAAAAGATGCTACCACTTCATCCATGCCGAAGAT
GTAGAAGGCATCAGGCACAGTCACCTGGACTTGCTGAATAAGGGTCAGTGTGTGACCAAGTACTACCGCT
GGATGCAGAAGAATGGAGGCTACATCTGGATACAGTCTAGTGCCACCATAGCTATTAATGCGAAGAATGC
AAATGAGAAGAACATCATCTGGGTGAATTATCTTCTTAGTAATCCGGAGTACAAGGACACACCCATGGAC
ATT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 74752. Forward Primer - name:074752_F_cDNA_Npas3, sequence:TCCTCTTCTCAGTCAGAGACCC; Reverse Primer - name:074752_N_SP6_cDNA_Npas3, sequence:AATGTCCATGGGTGTGTCCTT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19976 same embryo
 EMAGE:19974 same embryo
 EMAGE:19973 same embryo
 EMAGE:19972 same embryo
 EMAGE:19975 same embryo
 EurExpress:euxassay_009424 same experiment
 MGI:4826759 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS