Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20086

Als2 amyotrophic lateral sclerosis 2 (juvenile) homolog (human) ( MGI:1921268)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20086 EMAGE:20086 EMAGE:20086 EMAGE:20086 EMAGE:20086
"Pseudo-wholemount" of euxassay_002036. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_002036_01 euxassay_002036_02 euxassay_002036_03 euxassay_002036_04
EMAGE:20086 EMAGE:20086 EMAGE:20086 EMAGE:20086 EMAGE:20086
euxassay_002036_05 euxassay_002036_06 euxassay_002036_07 euxassay_002036_08 euxassay_002036_09
EMAGE:20086 EMAGE:20086 EMAGE:20086 EMAGE:20086 EMAGE:20086
euxassay_002036_10 euxassay_002036_11 euxassay_002036_12 euxassay_002036_13 euxassay_002036_14
EMAGE:20086 EMAGE:20086 EMAGE:20086 EMAGE:20086 EMAGE:20086
euxassay_002036_15 euxassay_002036_16 euxassay_002036_17 euxassay_002036_18 euxassay_002036_19
EMAGE:20086 EMAGE:20086 EMAGE:20086 EMAGE:20086 EMAGE:20086
euxassay_002036_20 euxassay_002036_21 euxassay_002036_22 euxassay_002036_23 euxassay_002036_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20086Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20086_wholemount_strong.wlz
20086_wholemount_moderate.wlz
20086_wholemount_weak.wlz
20086_wholemount_possible.wlz
20086_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20086_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
thymus primordium
moderate moderate
homogeneousmoderate expression: see section 10 11 12 13 14
brain
weak weak
homogeneousweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 17 19 20 21 weak expression: see section 18
spinal cord
weak weak
homogeneousweak expression: see section 08 09 10 11 12 13 14 15 16
dorsal root ganglion
weak weak
regionalweak expression: see section 08 09 10 11 12 16 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2413
Entity Detected:Als2, amyotrophic lateral sclerosis 2 (juvenile) homolog (human) ( MGI:1921268)
Sequence:sense strand is shown

>T2413
TGGCCTCGAGCCAGAATTCGGACGAGGCTTTCCTGTAGTGAAAGCTCTCAGCTCCATGCAGTTCCAGGAA
ACCTTTCCAGGAAAGCTGCTTAGATGAAAAGAAGTTGATGACTGTGTTTAAGCTCCTGGTTTGTCTAATT
CCATTTGCAGTTACCCAATACCCTTTGGCAAGGAGCAGGTTTTACTTGAACTGAAGCAGCCATCCCTTGC
CTTCCTAGACCTCTCCCAGGCACAAGTGCAGCATGCTACTTTGCTAGGGGTGGGGGTGGGGGAGAAGAAG
TTTTAAACTGTAGTTTTAACCTTTTGTAAGCCCCTTTACCAAGGCATTTGTGGTCAGAGAGCTCCCACGG
GGTGACTATGACATCCTGGTCCCCTCGTGGAATGCATCCACATAGGATCTTCTGCCTGCTGACTGAAAAG
AACATAGGAATACACTGGAGTGCAAACACTGCCGTGCCAAGCTGCTCCAAACCTCACTGATCCGAGGCCC
ACTGCCTACCCAGGAGGCCCGTAAGCTTCTTAGCACAAGCTTTGTGTGGAGACTGAA
Notes:The probe template was PCR amplified from IMAGE:1226365 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1226365 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20084 same embryo
 EMAGE:20085 same embryo
 EMAGE:20083 same embryo
 EurExpress:euxassay_002036 same experiment
 MGI:4823097 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS