Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20214

Ppp2r1b protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65), beta isoform ( MGI:1920949)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20214 EMAGE:20214 EMAGE:20214 EMAGE:20214 EMAGE:20214
"Pseudo-wholemount" of euxassay_012306. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012306_01 euxassay_012306_02 euxassay_012306_03 euxassay_012306_04
EMAGE:20214 EMAGE:20214 EMAGE:20214 EMAGE:20214 EMAGE:20214
euxassay_012306_05 euxassay_012306_06 euxassay_012306_07 euxassay_012306_08 euxassay_012306_09
EMAGE:20214 EMAGE:20214 EMAGE:20214 EMAGE:20214 EMAGE:20214
euxassay_012306_10 euxassay_012306_11 euxassay_012306_12 euxassay_012306_13 euxassay_012306_14
EMAGE:20214 EMAGE:20214 EMAGE:20214 EMAGE:20214 EMAGE:20214
euxassay_012306_15 euxassay_012306_16 euxassay_012306_17 euxassay_012306_18 euxassay_012306_19
EMAGE:20214 EMAGE:20214 EMAGE:20214
euxassay_012306_20 euxassay_012306_21 euxassay_012306_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20214Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20214_wholemount_strong.wlz
20214_wholemount_moderate.wlz
20214_wholemount_weak.wlz
20214_wholemount_possible.wlz
20214_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20214_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
thymus primordium
weak weak
regionalweak expression: see section 11 12 13 14 15
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 07 08 09 16 17 18
cerebral cortex mantle layer
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 13 14 15 16 17 18 19 20 21
lower jaw incisor
weak weak
regionalweak expression: see section 12 13
lower jaw molar
moderate moderate
regionalmoderate expression: see section 06 07 18
upper jaw incisor
weak weak
regionalweak expression: see section 12
upper jaw molar
moderate moderate
regionalmoderate expression: see section 06 07 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30450
Entity Detected:Ppp2r1b, protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65), beta isoform ( MGI:1920949)
Sequence:sense strand is shown

>T30450
CCAGCCAGAGGAGGAAGAACATGGCGGGCGCAGCAGGGCCAGGGTCCGGTCCGGGGGCAGCGGGTGGAGA
TGGAGACGATTCGCTCTACCCGATCGCGGTTTTAATCGACGAGCTCCGCAATGAGGACGTGCAGCTCCGT
CTCAACAGTATTAAGAAGTTATCAACTATAGCTCTAGCACTCGGGGTAGAAAGGACTCGAACGGAACTGC
TGCCTTTCCTTACAGATACTATTTATGATGAAGATGAGGTGCTGTTAGCTCTCGCCGAGCAGCTGGGAAA
TTTCACTGGTTTGGTGGGCGGTCCTGACTTTGCCCACTGTCTGCTGCCTCCTTTGGAAAGTTTGGCTACG
GTGGAGGAGACTGTCGTTCGAGACAAGGCTGTGGAGTCGCTGAGGCAGATCTCGCAGGAGCACACTCCTG
TTGCCCTTGAAGCTCATTTTGTGCCTCTGGTGAAGCGCCTGGCAAGCGGGGACTGGTTCATGTCGCGCAC
GTCTGCATGTGGCTTGTTCAGCGTTTGCTATCCCAGAGCTTCAAATGCTGTCAAGGCAGAGATTCGACAG
CACTTCCGTTCTCTCTGCTCGGATGATACACCAATGGAGCGACGTGCTGCTGCTTCCAAATTGG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:30016074), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 58905. Forward Primer - name:058905_F_IRAV106_a10_Ppp2r1b, sequence:CCAGCCAGAGGAGGAAGA; Reverse Primer - name:058905_R_SP6_IRAV106_a10_Ppp2r1b, sequence:CCCAATTTGGAAGCAGCA. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20213 same embryo
 EMAGE:20216 same embryo
 EMAGE:20215 same embryo
 EMAGE:20217 same embryo
 EurExpress:euxassay_012306 same experiment
 MGI:4827384 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS