Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20279

Slc22a8 solute carrier family 22 (organic anion transporter), member 8 ( MGI:1336187)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20279 EMAGE:20279 EMAGE:20279 EMAGE:20279 EMAGE:20279
"Pseudo-wholemount" of euxassay_012390. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012390_01 euxassay_012390_02 euxassay_012390_03 euxassay_012390_04
EMAGE:20279 EMAGE:20279 EMAGE:20279 EMAGE:20279 EMAGE:20279
euxassay_012390_05 euxassay_012390_06 euxassay_012390_07 euxassay_012390_08 euxassay_012390_09
EMAGE:20279 EMAGE:20279 EMAGE:20279 EMAGE:20279 EMAGE:20279
euxassay_012390_10 euxassay_012390_11 euxassay_012390_12 euxassay_012390_13 euxassay_012390_14
EMAGE:20279 EMAGE:20279 EMAGE:20279 EMAGE:20279 EMAGE:20279
euxassay_012390_15 euxassay_012390_16 euxassay_012390_17 euxassay_012390_18 euxassay_012390_19
EMAGE:20279 EMAGE:20279 EMAGE:20279
euxassay_012390_20 euxassay_012390_21 euxassay_012390_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20279Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20279_wholemount_strong.wlz
20279_wholemount_moderate.wlz
20279_wholemount_weak.wlz
20279_wholemount_possible.wlz
20279_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20279_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall mantle layer
moderate moderate
single cellmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17
diencephalon meninges
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19
telencephalon mantle layer
moderate moderate
single cellmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
telencephalon meninges
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
medulla oblongata alar plate mantle layer
moderate moderate
single cellmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17 18
medulla oblongata basal plate mantle layer
moderate moderate
single cellmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17 18
hindbrain meninges
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
rest of cerebellum mantle layer
moderate moderate
single cellmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
pons mantle layer
moderate moderate
single cellmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
midbrain meninges
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19 20
midbrain mantle layer
moderate moderate
single cellmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17 18
spinal cord mantle layer
moderate moderate
single cellmoderate expression: see section 10 11 12 13 14 15 16
spinal cord meninges
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31283
Entity Detected:Slc22a8, solute carrier family 22 (organic anion transporter), member 8 ( MGI:1336187)
Sequence:sense strand is shown

>T31283
GTTGACATTCCCGCCAAGTTCATCACAATCCTCTCCATAAGTTATCTGGGCCGGCGCATCACTCAGGGCT
TCCTCCTGATCCTGGCAGGAGTGGCCATCCTGGCCCTCATCTTTGTGTCTTCAGAAATGCAGCTCTTGAG
AACAGCACTGGCTGTATTTGGGAAGGGATGCCTGTCTGGCTCCTTCAGCTGCCTCTTCCTCTACACAAGT
GAGCTCTACCCTACAGTCCTCAGGCAAACAGGTATGGGTATCAGTAACATATGGGCTCGAGTGGGAAGTA
TGATAGCCCCACTGGTGAAAATCACGGGAGAACTGCAGCCCTTCATCCCTAATGTCATCTTTGGGACCAT
GACTCTACTGGGAGGCAGTGCTGCCTTCTTTCTGCTTGAGACCCTCAATCGGCCCTTACCAGAAACTATC
GAGGACATACAAGACTGGTACCAGCAAACCAAGAAAACAAAGCAGGAGCCAGAAGCAGAAAAGGCATCCC
AGACAATCCCGCTGAAGACTGGTGGACCCTAGCTAAGAACAACAGAATCCTCTTTCCTGCCTTCCAGAGA
CTGATCCCAAGCAGGGCCCTTCCAAGGCTATTCGAGCACCTTAGGGGTTGGGTGGAGCCCCAGCTGGCTC
CATGCTCTCAGAACAAAGACTTCTGAGAGTTCAGCAAAAGTGTTTTACCTTCACCACCTCCACCGTAGCC
CACAACCCAGACCTGGCCTGTTCACAGCCCTAGCCATACTCACTCCTGCACTCATCCTCCCTGCAACCCA
GGCCCTGCCATTTTTCTCTACCCTCTTTGTATTGGCCATTTCCTCCATTGTCCCACCTCCATTTCCCTTT
GAGATTCCCTGGCAGTTCTAATGGTTTCCTCTTACCTTCCCCAAACTCTCTCCTTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4239544), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 55942. Forward Primer - name:055942_F_IRAV50_c08_Slc22a8, sequence:GTTGACATTCCCGCCAAG; Reverse Primer - name:055942_R_SP6_IRAV50_c08_Slc22a8, sequence:CCAAGGAGAGAGTTTGGGG. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20280 same embryo
 EMAGE:20278 same embryo
 EMAGE:20276 same embryo
 EMAGE:20277 same embryo
 EurExpress:euxassay_012390 same experiment
 MGI:4828140 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS