Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20298

Ntm neurotrimin ( MGI:2446259)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20298 EMAGE:20298 EMAGE:20298 EMAGE:20298 EMAGE:20298
"Pseudo-wholemount" of euxassay_012548. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012548_01 euxassay_012548_02 euxassay_012548_03 euxassay_012548_04
EMAGE:20298 EMAGE:20298 EMAGE:20298 EMAGE:20298 EMAGE:20298
euxassay_012548_05 euxassay_012548_06 euxassay_012548_07 euxassay_012548_08 euxassay_012548_09
EMAGE:20298 EMAGE:20298 EMAGE:20298 EMAGE:20298 EMAGE:20298
euxassay_012548_10 euxassay_012548_11 euxassay_012548_12 euxassay_012548_13 euxassay_012548_14
EMAGE:20298 EMAGE:20298 EMAGE:20298 EMAGE:20298 EMAGE:20298
euxassay_012548_15 euxassay_012548_16 euxassay_012548_17 euxassay_012548_18 euxassay_012548_19
EMAGE:20298 EMAGE:20298 EMAGE:20298 EMAGE:20298 EMAGE:20298
euxassay_012548_20 euxassay_012548_21 euxassay_012548_22 euxassay_012548_23 euxassay_012548_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20298Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20298_wholemount_strong.wlz
20298_wholemount_moderate.wlz
20298_wholemount_weak.wlz
20298_wholemount_possible.wlz
20298_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20298_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
forelimb digit 1 mesenchyme
moderate moderate
regionalmoderate expression: see section 01 03
forelimb digit 2 mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 03 04 20 21
forelimb digit 3 mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 19 20 21 23
hindlimb digit 1 mesenchyme
moderate moderate
regionalmoderate expression: see section 17 18
hindlimb digit 2 mesenchyme
moderate moderate
regionalmoderate expression: see section 01 15 16 17 18
hindlimb digit 3 mesenchyme
moderate moderate
regionalmoderate expression: see section 01 03 15 16 17 18
hindlimb digit 4 mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 03 15 16 17 18
hindlimb digit 5 mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 03 16 17
mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
diencephalon lateral wall mantle layer
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17 18 19
diencephalon meninges
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19 20
telencephalon mantle layer
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
telencephalon meninges
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
medulla oblongata alar plate mantle layer
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17 18 19
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17 18 19
hindbrain meninges
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
rest of cerebellum mantle layer
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
pons mantle layer
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
midbrain meninges
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19 20
midbrain mantle layer
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19 20
facial vii ganglion
strong strong
regionalstrong expression: see section 05 06 21
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 08 19
trigeminal v ganglion
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 17 18 19 20 21 22 23
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 06 07 08 09 18 19 20 21
spinal cord mantle layer
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 16 17 18
spinal cord meninges
strong strong
regionalstrong expression: see section 12 13 14 15 16 17 18
dorsal root ganglion
strong strong
regionalstrong expression: see section 08 09 10 13 14 15 16 17 18 19 20
neural retina
strong strong
regionalstrong expression: see section 01 02 23 24
axial skeleton tail region
strong strong
regionalstrong expression: see section 09 10 11 moderate expression: see section 08
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31438
Entity Detected:Ntm, neurotrimin ( MGI:2446259)
Sequence:sense strand is shown

>T31438
ACCTCCAGGGTCCACCTCATTGTACAAGTATCTCCCAAAATTGTAGAGATTTCTTCAGATATCTCCATTA
ATGAAGGGAACAACATCAGCCTCACTTGCATAGCCACAGGTAGACCGGAGCCTACAGTAACCTGGAGACA
TATTTCTCCCAAGGCCGTTGGCTTTGTGAGTGAGGATGAGTACCTGGAGATCCAGGGCATCACTCGGGAA
CAGTCAGGCGAGTACGAGTGCAGCGCCTCCAACGACGTGGCGGCACCAGTGGTACGAAGAGTGAAGGTCA
CCGTGAACTATCCACCATACATCTCAGAAGCTAAGGGCACAGGTGTCCCCGTGGGGCAGAAGGGGACTCT
GCAGTGTGAAGCTTCCGCAGTCCCTTCAGCAGAATTTCAATGGTTCAAGGATGACAAAAGACTGGTCGAA
GGAAAGAAGGGAGTCAAAGTGGAAAACAGACCTTTCCTTTCAAAACTCACCTTTTTCAACGTCTCTGAAC
ATGACTATGGGAACTACACATGTGTGGCCTCCAACAAGCTGGGTCACACCAACGCCAGCATCATGCTATT
TGGTCCCGGTGCTGTCAGTGAGGTCAACAATGGGACATCAAGGAGGGCAGGCTGCATTTGGCTCCTCCCT
CTTCTGGTCTTACACCTGCTCCTCAAATTTTGATGTGAGTGCCCCTTCCCTGCTGGGGAGAGCTGCTGCC
ACCGCATCTCAATACAACAGCACTGCAAAATGAAGCAACAAGTCAGAATCAAATGAAATTCCGAGAATCA
CAGCCAATGAGACAGAAATTCGAGGGAGGGGGACAAAGCATACTGTGGTAAAGGGGAAAAAAAGGTTTAA
GAAAAGGAAATTTGGAAATTGCCTTGCAGATATTTCGGTACCGCTGAGTTTTCTTTCTTTTCCCAAGTGG
GAAGAAGGCACACCTAGCTTGGACCCACCCACAAGCTGCACT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4480983), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 25631. Forward Primer - name:025631_F_IRAV59-62_G06_Hnt, sequence:ACCTCCAGGGTCCACCTC; Reverse Primer - name:025631_R_SP6_IRAV59-62_G06_Hnt, sequence:CAGTGCAGCTTGTGGGTG. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20295 same embryo
 EMAGE:20296 same embryo
 EMAGE:20297 same embryo
 EMAGE:20294 same embryo
 EMAGE:20293 same embryo
 EurExpress:euxassay_012548 same experiment
 MGI:4826816 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS