Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20304

Elmo1 engulfment and cell motility 1, ced-12 homolog (C. elegans) ( MGI:2153044)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20304 EMAGE:20304 EMAGE:20304 EMAGE:20304 EMAGE:20304
"Pseudo-wholemount" of euxassay_012546. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012546_01 euxassay_012546_02 euxassay_012546_03 euxassay_012546_04
EMAGE:20304 EMAGE:20304 EMAGE:20304 EMAGE:20304 EMAGE:20304
euxassay_012546_05 euxassay_012546_06 euxassay_012546_07 euxassay_012546_08 euxassay_012546_09
EMAGE:20304 EMAGE:20304 EMAGE:20304 EMAGE:20304 EMAGE:20304
euxassay_012546_10 euxassay_012546_11 euxassay_012546_12 euxassay_012546_13 euxassay_012546_14
EMAGE:20304 EMAGE:20304 EMAGE:20304 EMAGE:20304 EMAGE:20304
euxassay_012546_15 euxassay_012546_16 euxassay_012546_17 euxassay_012546_18 euxassay_012546_19
EMAGE:20304 EMAGE:20304
euxassay_012546_20 euxassay_012546_21

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20304Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20304_wholemount_strong.wlz
20304_wholemount_moderate.wlz
20304_wholemount_weak.wlz
20304_wholemount_possible.wlz
20304_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20304_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
vibrissa
moderate moderate
regionalmoderate expression: see section 01 02 03 04 19 20 21
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 10 11 12 13 14 15 16 17
diencephalon lateral wall marginal layer
moderate moderate
regionalmoderate expression: see section 09
thalamus mantle layer
strong strong
regionalstrong expression: see section 09 10 13 14
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
medulla oblongata floor plate
strong strong
regionalstrong expression: see section 11
medulla oblongata alar plate mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16
metencephalon floor plate
strong strong
regionalstrong expression: see section 11
rest of cerebellum mantle layer
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18
pons mantle layer
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18
midbrain floor plate
strong strong
regionalstrong expression: see section 12 13
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18
spinal cord mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31431
Entity Detected:Elmo1, engulfment and cell motility 1, ced-12 homolog (C. elegans) ( MGI:2153044)
Sequence:sense strand is shown

>T31431
AGCCAGTTAGCCCCAAGCTGCCCCATATTTGCTCACCAAACCAAGAGAAATTCCTAAGGCCAGGGTTGGA
TAAAATAGCTCTGCTACTGGATTAGAAGACCAAAGGCCTCCTACCCCTTCTCTCTAGGGTCACCTCACAC
CATCAGCTCTATGTGAGTTGAGATTGCTTTCACATTGCCTCTCTCTCCCTTTCCTGCCTTGGCCTTGCTC
TGGTCCACTTTGGTCTCACATGTAGCAGCAGCATCCTCATTGTAGTTGTCTACAGCATCAGGTCTCCCAA
ACTGTCCACAGAGTCCATGCCTGTTCCTTGTCTGCACTGTGACCATGACCAATCCCTCTATCACACTGTC
TAGTCTTGGGCTTCCTCTCTTTGCCCCAGCCCAGGCCTGCCTTCTTCATTTCTTCGAGCTCCCAGCCCTT
AGCAGAAAGCACAAATGAAGTCAGTAGTCCTGCTCCATCTCTGATAAACTAAACCTAACCGCCCCTAAGG
CGGCTGTTGCTATCTAACAGTTCCGTGTGACCTTCTCTCTGGGGCTCCTGCTACAGCCCAGGTTTTCCAG
GGTGGTCAAGCTGTCAGACATCCAAGTTTACATCGTTGTAATTATTATAGGTCTTTAAATTTTACAAGGG
TTTGGGGTTATTTTGTTTTGTTTTGTTGGCTTTGTTTTTGTATAAAAGAGTCTAACATTTTTTTGCCAAA
CAGATATATATTTAATGAAGAGATACATAAATGTGTGTACTTTCCAGCTTTTTTTTAAATTATTTTAATC
CCAAACATCTTCCTGAGAGTAACACTCCCTTAAACATGCTGTGG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:3990906), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 25961. Forward Primer - name:025961_F_IRAV59-62_E03_Elmo1, sequence:AGCCAGTTAGCCCCAAGC; Reverse Primer - name:025961_R_SP6_IRAV59-62_E03_Elmo1, sequence:TCCACAGCATGTTTAAGGGA. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20307 same embryo
 EMAGE:20306 same embryo
 EMAGE:20308 same embryo
 EMAGE:20303 same embryo
 EMAGE:20305 same embryo
 EurExpress:euxassay_012546 same experiment
 MGI:4824526 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS