Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20308

Trp53bp1 transformation related protein 53 binding protein 1 ( MGI:1351320)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20308 EMAGE:20308 EMAGE:20308 EMAGE:20308 EMAGE:20308
"Pseudo-wholemount" of euxassay_012562. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012562_01 euxassay_012562_02 euxassay_012562_03 euxassay_012562_04
EMAGE:20308 EMAGE:20308 EMAGE:20308 EMAGE:20308 EMAGE:20308
euxassay_012562_05 euxassay_012562_06 euxassay_012562_07 euxassay_012562_08 euxassay_012562_09
EMAGE:20308 EMAGE:20308 EMAGE:20308 EMAGE:20308 EMAGE:20308
euxassay_012562_10 euxassay_012562_11 euxassay_012562_12 euxassay_012562_13 euxassay_012562_14
EMAGE:20308 EMAGE:20308 EMAGE:20308 EMAGE:20308 EMAGE:20308
euxassay_012562_15 euxassay_012562_16 euxassay_012562_17 euxassay_012562_18 euxassay_012562_19
EMAGE:20308 EMAGE:20308
euxassay_012562_20 euxassay_012562_21

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20308Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20308_wholemount_strong.wlz
20308_wholemount_moderate.wlz
20308_wholemount_weak.wlz
20308_wholemount_possible.wlz
20308_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20308_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
brain
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 18 19
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 17
trigeminal v ganglion
strong strong
regionalstrong expression: see section 17 moderate expression: see section 03 04 05 06 07 08 16 18 19 20
vagus x ganglion
strong strong
regionalstrong expression: see section 17 moderate expression: see section 07 16
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 17 moderate expression: see section 06 07 16 18
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 08
spinal cord
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 16 17
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 09 15
cervical ganglion
moderate moderate
regionalmoderate expression: see section 07 08 16
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 12
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 13 14 15 16 17
retina
strong strong
regionalstrong expression: see section 01 moderate expression: see section 02 03 20 21
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 13 14 15 16 17
vomeronasal organ
moderate moderate
regionalmoderate expression: see section 13
metanephros
moderate moderate
regionalmoderate expression: see section 07 08 09 10 16 18 19
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31432
Entity Detected:Trp53bp1, transformation related protein 53 binding protein 1 ( MGI:1351320)
Sequence:sense strand is shown

>T31432
GGGGGACATCAGCTCCTTCTCCTCCAAAGCTTCCAGCTCACACCACACATCCAGTGGAACAAGTCTCTCA
GCCATACACAGCAGTGGCAGCTCAGGGCGAGGAGCTGGGCCACTCAAAGGAAAAGCCAGTGGGACAGAAG
CTGCAGATTTTGCCTTACCCAGTTCCCGAGGAGGCCCAGGAAAACTGAGTCCTAGAAAAGGGATCAGTCA
GACAGGGGCACCGGTGTGTGAGGAAGATGGTGATGCAGGCCTTGGCATCAGACAGGGAGGGAAGGCTCCA
GTTACACCTCGTGGGCGTGGGCGAAGGGGCCGCCCACCTTCTCGGACCACTGGAACCAGAGAAACAGTTG
TCTCTGGTCCGTTGGGCGTAGAAGATATTTCACCTAGCATGTCACCAGATGACAAGTCCTTCACCCGCAT
TATGCCTCGTGTGCCAGATTCTACCAAACGGACGGATGCCAGTTCTAGTACTTTGCGGCGGAGTGATTCT
CCAGAGATTCCTTTTCAGGCTGCTACTGGTTCCTCTGATGGCTTGGATTCCTCATCTTCAGGAAACAGCT
TTGTGGGTCTCCGTGTTGTAGCTAAGTGGTCATCCAATGGCTACTTTTACTCTGGGAAGATCACCCGAGA
TGTGGGGGCTGGGAAGTACAAGCTGCTCTTTGATGATGGGTACGAATGTGACGTGCTGGGCAAAGACATT
CTCCTGTGTGACCCCATCCCCCTGGACACTGAAGTGACAGCCCTCTCAGAAGATGAATATTTCAGTGCAG
GAGTGGTGAAAGGACATAGGAAGGAGTCTGGGGAGCTGTATTACAGCATTGAAAAAGAAGGCCAAAGGAA
GTGGTATAAACGAATGGCGGTCATTCTGTCCTTGGAGCAAGGAAACAGACTGAGAGAGCAATATGGGCTT
GGCCCATATGAAGCTGTCACACCGCTCACGAAGGCAGCAGATATCAGCTTAGACAATTTGGTGGAAGGAA
AGC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:3979746), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 25916. Forward Primer - name:025916_F_IRAV59-62_E19_Trp53bp1, sequence:GGGGGACATCAGCTCCTT; Reverse Primer - name:025916_R_SP6_IRAV59-62_E19_Trp53bp1, sequence:CGCTTTCCTTCCACCAAA. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20304 same embryo
 EMAGE:20307 same embryo
 EMAGE:20306 same embryo
 EMAGE:20303 same embryo
 EMAGE:20305 same embryo
 EurExpress:euxassay_012562 same experiment
 MGI:4828933 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS