Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20320

Pgm2l1 phosphoglucomutase 2-like 1 ( MGI:1918224)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20320 EMAGE:20320 EMAGE:20320 EMAGE:20320 EMAGE:20320
"Pseudo-wholemount" of euxassay_012530. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012530_01 euxassay_012530_02 euxassay_012530_03 euxassay_012530_04
EMAGE:20320 EMAGE:20320 EMAGE:20320 EMAGE:20320 EMAGE:20320
euxassay_012530_05 euxassay_012530_06 euxassay_012530_07 euxassay_012530_08 euxassay_012530_09
EMAGE:20320 EMAGE:20320 EMAGE:20320 EMAGE:20320 EMAGE:20320
euxassay_012530_10 euxassay_012530_11 euxassay_012530_12 euxassay_012530_13 euxassay_012530_14
EMAGE:20320 EMAGE:20320 EMAGE:20320 EMAGE:20320 EMAGE:20320
euxassay_012530_15 euxassay_012530_16 euxassay_012530_17 euxassay_012530_18 euxassay_012530_19
EMAGE:20320 EMAGE:20320 EMAGE:20320 EMAGE:20320
euxassay_012530_20 euxassay_012530_21 euxassay_012530_22 euxassay_012530_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20320Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20320_wholemount_strong.wlz
20320_wholemount_moderate.wlz
20320_wholemount_weak.wlz
20320_wholemount_possible.wlz
20320_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20320_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
brain
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
facial vii ganglion
strong strong
regionalstrong expression: see section 04 06 07 17 18 19 20
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 05 06 07 18
trigeminal v ganglion
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 16 17 18 19 20 21
vagus x ganglion
strong strong
regionalstrong expression: see section 07 08 16
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 05 06 07 08 16 17 18
trigeminal v nerve
strong strong
regionalstrong expression: see section 09
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 09 10 11 13 14 15 16 18
neural retina
strong strong
regionalstrong expression: see section 01 02 03 21 22 23
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 09 weak expression: see section 10 11 12 13 14 15 16
renal cortex
moderate moderate
regionalmoderate expression: see section 07 08 09 10 15 16 17 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31383
Entity Detected:Pgm2l1, phosphoglucomutase 2-like 1 ( MGI:1918224)
Sequence:sense strand is shown

>T31383
CAGATCCTGATGCCGACCGGCTGGCTGTGGCAGAACTTCAGGAGAATGGCCGTTGGAAAGTTTTCACAGG
AAATGAGCTGGCAGCTTTGTTTGGGTGGTGGATGTTTGATTGCTGGAAGAAAAACAAACCAAACGCCGAT
GTGAAGAATGTTTACATGCTAGCCACCACTGTCTCTTCTAAAATTTTAAAGGCAATTGCACTTAAAGAAG
GATTTCATTTTGAAGAAACATTACCAGGCTTTAAATGGATTGGAAGTAGGATAAAAGACCTCCTAGGAAA
TGGAAAAGAAGTCCTTTTTGCATTTGAAGAGTCTATTGGCTTTCTGTGTGGAACCTCCGTGTTGGACAAA
GATGGAGTGAGTGCAGCTGCTGTTGTTGCTGAGATGGCCTCTTTCCTGGATACCAGGAAGGTAACACTGA
TGGAGCAACTGACAAAAGTGTATGAAATATACGGTTACCATATGTCCAAAACTTCATATTTCTTGTGTTA
TGATCCACCTACCATCAAAACCATATTTGAAAGGATTCGAAATTTTGAGTCTCCAAAGGAATATCCAAAA
TTTTGTGGGGCTTTTGCTATTTTGCATGTACGGGACATAACCACTGGATATGATAGCAGCCAGCCAAATA
AGAAATCAGTACTGCCTGTGAGTAAAAACAGCCAAATGATTACATTTACCTTCCAAAACGGCTGTGTCGC
TACTCTCCGAACAAGTGGGACAGAACCGAAGATAAAGTATTATGCAGAGATGTGTGCATCGCCTGGCCAG
AGTGACACTACCTTCCTGGAAGAAGAATTAAAGAAACTCATTGACGCGCTGATAGAGAATTTTCTTGAGC
CCAGTAAGAACGCACTGGTCTGG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:5004308), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 24637. Forward Primer - name:024637_F_IRAV55-58_H23_Pgm2l1, sequence:CAGATCCTGATGCCGACC; Reverse Primer - name:024637_R_SP6_IRAV55-58_H23_Pgm2l1, sequence:GCCAGACCAGTGCGTTCT. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20322 same embryo
 EMAGE:20321 same embryo
 EMAGE:20319 same embryo
 EurExpress:euxassay_012530 same experiment
 MGI:4827176 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS