Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20359

Bicd2 bicaudal D homolog 2 (Drosophila) ( MGI:1924145)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20359 EMAGE:20359 EMAGE:20359 EMAGE:20359 EMAGE:20359
"Pseudo-wholemount" of euxassay_012575. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012575_01 euxassay_012575_02 euxassay_012575_03 euxassay_012575_04
EMAGE:20359 EMAGE:20359 EMAGE:20359 EMAGE:20359 EMAGE:20359
euxassay_012575_05 euxassay_012575_06 euxassay_012575_07 euxassay_012575_08 euxassay_012575_09
EMAGE:20359 EMAGE:20359 EMAGE:20359 EMAGE:20359 EMAGE:20359
euxassay_012575_10 euxassay_012575_11 euxassay_012575_12 euxassay_012575_13 euxassay_012575_14
EMAGE:20359 EMAGE:20359 EMAGE:20359 EMAGE:20359 EMAGE:20359
euxassay_012575_15 euxassay_012575_16 euxassay_012575_17 euxassay_012575_18 euxassay_012575_19
EMAGE:20359 EMAGE:20359 EMAGE:20359 EMAGE:20359 EMAGE:20359
euxassay_012575_20 euxassay_012575_21 euxassay_012575_22 euxassay_012575_23 euxassay_012575_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20359Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20359_wholemount_strong.wlz
20359_wholemount_moderate.wlz
20359_wholemount_weak.wlz
20359_wholemount_possible.wlz
20359_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20359_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall ventricular layer
strong strong
regionalstrong expression: see section 12 13 14 15
telencephalon ventricular layer
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
medulla oblongata alar plate ventricular layer
strong strong
regionalstrong expression: see section 13 18 19
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 13
rest of cerebellum ventricular layer
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 18 19 20 21 22
pons ventricular layer
strong strong
regionalstrong expression: see section 07 13
midbrain ventricular layer
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17
facial vii ganglion
strong strong
regionalstrong expression: see section 06 20 21
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 05 07 18 19
trigeminal v ganglion
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 17 18 19 20 21 22
vagus x ganglion
weak weak
regionalweak expression: see section 08 18
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 06 07 weak expression: see section 08 09 18 19
spinal cord ventricular layer
strong strong
regionalstrong expression: see section 11 12 13
dorsal root ganglion
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 14 15 16 17 18
neural retina
weak weak
regionalweak expression: see section 01 02 03 04
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 09 10 11 12 13 15 16 17 18 19
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31545
Entity Detected:Bicd2, bicaudal D homolog 2 (Drosophila) ( MGI:1924145)
Sequence:sense strand is shown

>T31545
AGCATGAAATCAAGCGCCTGGAGGAGGAGACAGAGTACCTCAACAGCCAGCTAGAGGATGCCATCCGGCT
TAAGGAGATCTCTGAACGGCAGTTGGAGGAGGCGCTGGAGACACTGAAGACAGAGCGGGAGCAGAAGAAC
AACCTGCGCAAGGAGTTGTCGCACTACATGAGCATCAACGATTCCTTCTATACCAGCCACCTGCAGGTCT
CCTTAGATGGCCTCAAGTTCAGTGATGATACTGTCACCGCAGAGCCCAACAATGACGCCGAAGCCCTGGT
CAATGGCTTTGAGCACAGTGGCTTGGTCAAATCATCCTTGGACAACAAGACATCCACACCCAGGAAGGAT
GGCCTAGCTCCACCCTCCCCCAGCCTCGTCTCTGACCTGCTCAGTGAGCTCCACATATCTGAGATCCAGA
AGCTGAAACAGCAGCTGGTGCAGATGGAGCGGGAGAAGGTGGGCCTGCTGGCAACACTGCAGGACACACA
GAAGCAGCTGGAGCAGGCTCGGGGAACCCTCTCTGAGCAGCATGAGAAGGTGAATCGTCTCACAGAGAAC
CTTAGTGCCCTCCGGCGCCTGCAGGCTGGCAAGGAGCGACAGACCTCGTTGGATAATGAGAAGGACCGTG
ACAGCCACGAAGACGGTGACTACTATGAGGTGGACATCAATGGGCCTGAGATCCTGGCCTGCAAGTACCA
CGTGGCTGTGGCTGAGGCTGGCGAGCTCCGGGAGCAGCTCAAGGCGTTGCGCAGCACACACGAAGCTCGC
GAAGCCCAGCACGCAGAAGAAAAGGGCCGGTATGAGGCTGAGGGCCA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:5324113), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 31401. Forward Primer - name:031401_F_IRAV67-70_L14_Bicd2, sequence:AGCATGAAATCAAGCGCC; Reverse Primer - name:031401_R_SP6_IRAV67-70_L14_Bicd2, sequence:CTGGCCCTCAGCCTCATA. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20361 same embryo
 EMAGE:20360 same embryo
 EMAGE:20358 same embryo
 EMAGE:20363 same embryo
 EMAGE:20362 same embryo
 EurExpress:euxassay_012575 same experiment
 MGI:4823473 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS