Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20481

Dach1 dachshund 1 (Drosophila) ( MGI:1277991)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20481 EMAGE:20481 EMAGE:20481 EMAGE:20481 EMAGE:20481
"Pseudo-wholemount" of euxassay_012739. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012739_01 euxassay_012739_02 euxassay_012739_03 euxassay_012739_04
EMAGE:20481 EMAGE:20481 EMAGE:20481 EMAGE:20481 EMAGE:20481
euxassay_012739_05 euxassay_012739_06 euxassay_012739_07 euxassay_012739_08 euxassay_012739_09
EMAGE:20481 EMAGE:20481 EMAGE:20481 EMAGE:20481 EMAGE:20481
euxassay_012739_10 euxassay_012739_11 euxassay_012739_12 euxassay_012739_13 euxassay_012739_14
EMAGE:20481 EMAGE:20481 EMAGE:20481 EMAGE:20481 EMAGE:20481
euxassay_012739_15 euxassay_012739_16 euxassay_012739_17 euxassay_012739_18 euxassay_012739_19
EMAGE:20481 EMAGE:20481 EMAGE:20481 EMAGE:20481
euxassay_012739_20 euxassay_012739_21 euxassay_012739_22 euxassay_012739_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20481Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20481_wholemount_strong.wlz
20481_wholemount_moderate.wlz
20481_wholemount_weak.wlz
20481_wholemount_possible.wlz
20481_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20481_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
moderate moderate
regionalmoderate expression: see section 12 13 14 15 16
oral region
strong strong
regionalstrong expression: see section 19 20
dermis
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 11 12 13 14 19 20 21 22 23
diencephalon lateral wall mantle layer
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17 18
diencephalon meninges
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17 18 19
telencephalon mantle layer
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
telencephalon meninges
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
telencephalon ventricular layer
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
medulla oblongata alar plate mantle layer
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 16 17 18 19 20
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 09 11 12 13 14 15 16 17 18 19 20
hindbrain meninges
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
rest of cerebellum mantle layer
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
rest of cerebellum ventricular layer
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
pons mantle layer
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
midbrain meninges
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
midbrain mantle layer
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19 20
midbrain ventricular layer
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17 18
facial vii ganglion
strong strong
regionalstrong expression: see section 05 06 22
trigeminal v ganglion
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 17 18 19 20 21 22 23
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 17 18 19 20 21 22
spinal cord mantle layer
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 16 17 18
spinal cord meninges
strong strong
regionalstrong expression: see section 11 12 13 14 15 16 17 18
dorsal root ganglion
strong strong
regionalstrong expression: see section 09 10 11 14 15 16 17 18 19
retina
strong strong
regionalstrong expression: see section 01 02 03 22 23
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 13 14 15 16 17
vomeronasal organ
strong strong
regionalstrong expression: see section 10 11 13 14
pharynx
strong strong
regionalstrong expression: see section 12 13 14 15 16
stomach
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10
midgut
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18 19
bladder
strong strong
regionalstrong expression: see section 11 12 13
kidney calyx
strong strong
regionalstrong expression: see section 07 08 18 19
kidney pelvis
strong strong
regionalstrong expression: see section 08
ureter
strong strong
regionalstrong expression: see section 09 10 13 14 15 16 17
renal cortex
strong strong
regionalstrong expression: see section 06 07 08 09 10 16 17 18 19 20
genital tubercle of male
strong strong
regionalstrong expression: see section 10 11 12 13 14
urethra of male
strong strong
regionalstrong expression: see section 12
left lung
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13
right lung
moderate moderate
regionalmoderate expression: see section 13 14 15 16 17 18 19 20 21 22 23
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38222
Entity Detected:Dach1, dachshund 1 (Drosophila) ( MGI:1277991)
Sequence:sense strand is shown

>T38222
GTTAGCCATCCTCTCAACCATCTGCAGCACAGCCACCTTCCGCCAAATGGACTGGAACTTCCTTTTATGA
TGATGCCCCACCCTCTCATTCCTGTCAGCCTACCTCCAGCATCTGTCACCATGGCAATGAGTCAGATGAA
CCACCTTAGCACCATTGCAAATATGGCGGCGGCAGCACAAGTTCAGAGTCCTCCATCCAGGGTGGAGACA
TCTGTTATTAAGGAGCGTGTTCCCGACAGCCCCTCGCCTGCTCCATCTCTGGAGGAGGGCCGGAGGCCCG
GCAGCCACCCATCCTCACACCGCAGCAGCAGTGTGTCCAGCTCCCCGGCGCGGACTGAGAGTTCTTCCGA
CAGAATCCCTGTCCATCAGAATGGCCTGTCCATGAACCAGATGCTTATGGGTTTATCCCCAAATGTGCTT
CCTGGGCCAAAGGAGGGGGATTTGGCTGGTCATGACATGGGGCATGAGTCAAAACGGATCCACATTGAAA
AAGATGAGACCCCACTTTCCACACCAACCGCAAGAGACAGCATCGACAAACTTTCTCTAACTGGGCATGG
ACAACCACTACCTCCCGGCTTTCCATCTCCCTTTCTGTTTCCTGATGGCCTGTCTTCCATAGAGACCCTT
CTCACTAACATACAGGGCCTCTTGAAAGTTGCCATAGACAATGCCAGAGCTCAAGAAAAGCAGGTCCAAC
TGGAAAAAACAGAGCTGAAGATGGATTTTTTAAGAGAAAGAGAACTAAGAGAAACACTGGAGAAGCAGCT
GGCCATGGAACAAAAGAACAGAGCCATAGTTCAAAAGAGGCTAAAGAAGGAAAAGAAAGCAAAGAGAAAA
CTGCAGGAGGCACTAGAATTTGAGACAAAACGCCGTGAGCAAGCAGAGCAGACACTGAAACAGGCAGCTT
CA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 141627. Forward Primer - name:141627_F_cDNA_Dach1, sequence:GTTAGCCATCCTCTCAACCATC; Reverse Primer - name:141627_N_SP6_cDNA_Dach1, sequence:TGAAGCTGCCTGTTTCAGTGT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20478 same embryo
 EMAGE:20479 same embryo
 EMAGE:20477 same embryo
 EMAGE:20480 same embryo
 EMAGE:20476 same embryo
 EurExpress:euxassay_012739 same experiment
 MGI:4824219 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS