EMAGE mouse gene expression spatial database

EMAGE:20644

Olfr1106 olfactory receptor 1106 ( MGI:3030940)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


"Pseudo-wholemount" of euxassay_013908. This image has been made by aligning and collapsing the constitutent sections. Information about the method.	euxassay_013908_01	euxassay_013908_02	euxassay_013908_03	euxassay_013908_04

euxassay_013908_05	euxassay_013908_06	euxassay_013908_07	euxassay_013908_08	euxassay_013908_09

euxassay_013908_10	euxassay_013908_11	euxassay_013908_12	euxassay_013908_13	euxassay_013908_14

euxassay_013908_15	euxassay_013908_16	euxassay_013908_17	euxassay_013908_18	euxassay_013908_19

euxassay_013908_20	euxassay_013908_21	euxassay_013908_22

View assay images:
Expression pattern clarity:
Find spatially similar wholemount expression patterns:

Expression Pattern Description

Spatial Annotation:

Annotation colour key:

wholemount mapping

Download individual expression domains:

Download all expression domains:

Find spatially similar wholemount expression patterns:

Morphological match to the template:

Text Annotation:

Structure

Level

Pattern

Notes

nasal cavity olfactory epithelium

moderate

spotted

moderate expression: see section 08 17

Annotation Validation:

spatial mapping by EMAGE editor, text annotation by author

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T39165
Entity Detected:	Olfr1106, olfactory receptor 1106 ( MGI:3030940)
Sequence:	sense strand is shown >T39165 GTGGCCATTGTAAACCCACTAACCTACACAGTGGTTATGACAAAATTAATATGTGTTCTGCTAGTGTTGG GATCGTGCTTAGGAGGTACTATCACATCATTAACACATACAATTGGATTAATAAAATTGTCCTTCTGTGG GCCTAATGTCATCAGCCACTTCTTCTGTGACCTTCCTCCCCTGTTGAAGCTTTCCTGTTCTGACACATCC ATGAATGAACTGCTGCTTTTGGTGTTCTCTGGAGTCATTGCCATAACTACACTTTTGACCGTGGTTCTCT CTTA
Notes:	The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 279244. Forward Primer - name:279244_F_cDNA_Olfr1106, sequence:GTGGCCATTGTAAACCCACT; Reverse Primer - name:279244_N_SP6_cDNA_Olfr1106, sequence:TAAGAGAGAACCACGGTCAAA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:	RNA
Strand:	antisense
Label:	digoxigenin

Specimen

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EMAGE:20645 same embryo
	EMAGE:20643 same embryo
	EurExpress:euxassay_013908 same experiment
	MGI:4826863 same experiment
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source