Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20678

Ppt1 palmitoyl-protein thioesterase 1 ( MGI:1298204)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20678 EMAGE:20678 EMAGE:20678 EMAGE:20678 EMAGE:20678
"Pseudo-wholemount" of euxassay_013980. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013980_01 euxassay_013980_02 euxassay_013980_03 euxassay_013980_04
EMAGE:20678 EMAGE:20678 EMAGE:20678 EMAGE:20678 EMAGE:20678
euxassay_013980_05 euxassay_013980_06 euxassay_013980_07 euxassay_013980_08 euxassay_013980_09
EMAGE:20678 EMAGE:20678 EMAGE:20678 EMAGE:20678 EMAGE:20678
euxassay_013980_10 euxassay_013980_11 euxassay_013980_12 euxassay_013980_13 euxassay_013980_14
EMAGE:20678 EMAGE:20678 EMAGE:20678 EMAGE:20678 EMAGE:20678
euxassay_013980_15 euxassay_013980_16 euxassay_013980_17 euxassay_013980_18 euxassay_013980_19
EMAGE:20678 EMAGE:20678 EMAGE:20678 EMAGE:20678
euxassay_013980_20 euxassay_013980_21 euxassay_013980_22 euxassay_013980_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20678Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20678_wholemount_strong.wlz
20678_wholemount_moderate.wlz
20678_wholemount_weak.wlz
20678_wholemount_possible.wlz
20678_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20678_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
strong strong
regionalstrong expression: see section 11 12 13 14 15
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
medulla oblongata alar plate ventricular layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18
medulla oblongata basal plate ventricular layer
moderate moderate
regionalmoderate expression: see section 10 11 12 13
rest of cerebellum ventricular layer
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
pons ventricular layer
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15
spinal cord ventricular layer
moderate moderate
regionalmoderate expression: see section 09 10
seminiferous cord
strong strong
regionalstrong expression: see section 04 05 06 07 18 19
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T39431
Entity Detected:Ppt1, palmitoyl-protein thioesterase 1 ( MGI:1298204)
Sequence:sense strand is shown

>T39431
CAGTACTGGCATGACCCTATCAAGGAGAGTGTGTACCGAAACTACAGCATCTTCTTGGCAGACATAAATC
AAGAGAGGTGTGTCAATGAGTCCTACAAGAAGAACCTGATGGCCCTCAAGAAGTTTGTGATGGTGAAATT
CTTTAATGATTCCATTGTGGACCCTGTCGACTCTGAGTGGTTTGGATTTTACAGAAGTGGCCAAGCTAAG
GAAACCATTCCCCTCCAGGAGAGCACTCTATACACAGAGGACCGCCTGGGGCTAAAGAAAATGGACAAAG
CAGGAAAGCTAGTGTTTCTGGCTAAGGAAGGGGACCATCTTCAAATATCTAAAGAATGGTTTACTGCCCA
CATCATACCTTTTCTTAAGTGATGCCCTGGCACTTTATAGCAGAGTTCATGAAACCACAGCTCTTCCAAG
CCATGTACATAGTTCATGCTCAGCCTGAACTCTAATCTAGCCTGCAACCAGCCCTTCTCTCCTCTTATCA
TCTAACATACCCTACTTGGAAAGATCTAAGATCTCAATCTTATCCTTTGCCGCCTGCTATCACCATATGG
TGTTGGATTCAAGTTTAATTAGCTAATAACCATGGAGATTGTTTTACAACTTTGTGATATGGTCAAGCTC
CCGTTTAAGAAA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 98384. Forward Primer - name:098384_F_cDNA_Ppt1, sequence:CAGTACTGGCATGACCCTATCA; Reverse Primer - name:098384_N_SP6_cDNA_Ppt1, sequence:TTTCTTAAACGGGAGCTTGAC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20677 same embryo
 EMAGE:20676 same embryo
 EMAGE:20679 same embryo
 EMAGE:20675 same embryo
 EMAGE:20680 same embryo
 EurExpress:euxassay_013980 same experiment
 MGI:4827391 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS