Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20679

Musk muscle, skeletal, receptor tyrosine kinase ( MGI:103581)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20679 EMAGE:20679 EMAGE:20679 EMAGE:20679 EMAGE:20679
"Pseudo-wholemount" of euxassay_013976. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013976_01 euxassay_013976_02 euxassay_013976_03 euxassay_013976_04
EMAGE:20679 EMAGE:20679 EMAGE:20679 EMAGE:20679 EMAGE:20679
euxassay_013976_05 euxassay_013976_06 euxassay_013976_07 euxassay_013976_08 euxassay_013976_09
EMAGE:20679 EMAGE:20679 EMAGE:20679 EMAGE:20679 EMAGE:20679
euxassay_013976_10 euxassay_013976_11 euxassay_013976_12 euxassay_013976_13 euxassay_013976_14
EMAGE:20679 EMAGE:20679 EMAGE:20679 EMAGE:20679 EMAGE:20679
euxassay_013976_15 euxassay_013976_16 euxassay_013976_17 euxassay_013976_18 euxassay_013976_19
EMAGE:20679 EMAGE:20679 EMAGE:20679 EMAGE:20679 EMAGE:20679
euxassay_013976_20 euxassay_013976_21 euxassay_013976_22 euxassay_013976_23 euxassay_013976_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20679Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20679_wholemount_strong.wlz
20679_wholemount_moderate.wlz
20679_wholemount_weak.wlz
20679_wholemount_possible.wlz
20679_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20679_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
upper arm muscle
strong strong
regionalstrong expression: see section 01 02 03 04 05 23 24
upper leg muscle
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 17 18 19 20 21
diaphragm
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 19 20 21 22 23 24
forearm rest of mesenchyme
strong strong
regionalstrong expression: see section 01 02
hand
strong strong
regionalstrong expression: see section 02 03 04 05 24
foot
strong strong
regionalstrong expression: see section 06 07 08 21 22 23
lower leg rest of mesenchyme
strong strong
regionalstrong expression: see section 02 03 04 21 22 23 24
vertebral axis musculature
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
eye skeletal muscle
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 19 20 21 22 23 24
heart ventricle
moderate moderate
spottedmoderate expression: see section 13 14 17 18
tongue muscle
strong strong
regionalstrong expression: see section 11 12 13 14 15 16 17 18
tail paraxial mesenchyme
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T39430
Entity Detected:Musk, muscle, skeletal, receptor tyrosine kinase ( MGI:103581)
Sequence:sense strand is shown

>T39430
TCAAGAGAGTGTGAAAGACCGAGTGATTGACTCAAGACTCCAGCTCTTCATCACAAAGCCAGGACTCTAC
ACATGCATAGCTACCAATAAGCACGGAGAAAAGTTCAGTACCGCAAAGGCTGCAGCCACTGTCAGCATAG
CAGAATGGAGTAAGTCACAGAAAGACAGCCAAGGTTACTGTGCCCAGTACAGAGGGGAGGGTGTTTTGAT
GCAAGGCCCTGGCGAAAAGATGCTCTTGGTTTTTCTTCCAACAACCTCCCACCGGGACCCCGAGGACGCC
CAGGAGCTGCTGATCCACACTGCGTGGAATGAACTGAAGGCTGTGAGTCCACTGTGCCGGCCAGCTGCTG
AGGCTCTGCTGTGTTACCACCTCTTCCTAGAGTGCAGCCCTGGAGTGGTACCTACTCCCATGCCCATTTG
CAGAGAGTACTGCCTGGCGGTAAAGGAGCTCTTCTGTGCAAAGGAATGGCAGGCAATGGAAGGAAAGGCC
CACCGGGGCCTCTACAGATCTGGGATGCATCTCCTTCCGGTACCAGAGTGCAGAAAGCTTCCCAGCATGC
ACCGGGACCCCACAGCCTGCACAAGACTGCCATATTTAGATTATAAAAAGGAAAACATAACAACATTCCC
GTCAATAACGTCCTCCAGGCCGAGCGCGGACATTCCAAACCTGCCTGCCTCCACCTCTTCCTTTGCCGTC
TCGCCTGCGTACTCCATGACCGTCATCATCTCCATCGTGTCCAGCTTGGCCCTGTTTGCTCTTCTCACCA
TCGTTACTCTCTATTGCTGCCGAAGGAGGAAAGAATGGAAAAATAAGAAAAGAGAGTCGACCGCGGTGAC
CCTCACCACGTTGCCTTCCGAGCTCCTGCTGGATAGGCTCCATCCCAACCCCATGTACCAGAGGATGCCA
CTCCTTCTGAATCC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 99274. Forward Primer - name:099274_F_cDNA_Musk, sequence:TCAAGAGAGTGTGAAAGACCGA; Reverse Primer - name:099274_N_SP6_cDNA_Musk, sequence:GGATTCAGAAGGAGTGGCATC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20677 same embryo
 EMAGE:20676 same embryo
 EMAGE:20678 same embryo
 EMAGE:20675 same embryo
 EMAGE:20680 same embryo
 EurExpress:euxassay_013976 same experiment
 MGI:4826514 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS