Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20762

Ube2g1 ubiquitin-conjugating enzyme E2G 1 (UBC7 homolog, C. elegans) ( MGI:1914378)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20762 EMAGE:20762 EMAGE:20762 EMAGE:20762 EMAGE:20762
"Pseudo-wholemount" of euxassay_014056. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_014056_01 euxassay_014056_02 euxassay_014056_03 euxassay_014056_04
EMAGE:20762 EMAGE:20762 EMAGE:20762 EMAGE:20762 EMAGE:20762
euxassay_014056_05 euxassay_014056_06 euxassay_014056_07 euxassay_014056_08 euxassay_014056_09
EMAGE:20762 EMAGE:20762 EMAGE:20762 EMAGE:20762 EMAGE:20762
euxassay_014056_10 euxassay_014056_11 euxassay_014056_12 euxassay_014056_13 euxassay_014056_14
EMAGE:20762 EMAGE:20762 EMAGE:20762 EMAGE:20762 EMAGE:20762
euxassay_014056_15 euxassay_014056_16 euxassay_014056_17 euxassay_014056_18 euxassay_014056_19
EMAGE:20762 EMAGE:20762 EMAGE:20762 EMAGE:20762 EMAGE:20762
euxassay_014056_20 euxassay_014056_21 euxassay_014056_22 euxassay_014056_23 euxassay_014056_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20762Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20762_wholemount_strong.wlz
20762_wholemount_moderate.wlz
20762_wholemount_weak.wlz
20762_wholemount_possible.wlz
20762_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20762_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
submandibular gland primordium
weak weak
regionalweak expression: see section 07 08 09 10 17 18 19 20
medulla oblongata basal plate mantle layer
weak weak
regionalweak expression: see section 09 10 16 17
facial vii ganglion
weak weak
regionalweak expression: see section 04 05 20 21
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 07 19 20
trigeminal v ganglion
weak weak
regionalweak expression: see section 03 04 05 06 07 08 17 18 19 20 21 22
dorsal root ganglion
weak weak
regionalweak expression: see section 10 11 12 13 14 15 17 18 19 20
neural retina
moderate moderate
regionalmoderate expression: see section 01 weak expression: see section 02 22 23 24
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 06 07 08 09 10 11 13 14 15 16 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T40169
Entity Detected:Ube2g1, ubiquitin-conjugating enzyme E2G 1 (UBC7 homolog, C. elegans) ( MGI:1914378)
Sequence:sense strand is shown

>T40169
TCAACACACATCTAGCTCCAGGCACCGGCAGAGCTTGTCGCCAGTCCGTCGAAGTCCCGGTGGCGGCCCG
GGCTCTCGGTGGGGAGGATGACGGAGCTGCAGTCGGCGCTGCTACTGCGAAGACAGCTGGCAGAACTCAA
CAAAAATCCAGTGGAAGGCTTTTCAGCAGGTTTAATAGACGACAATGATCTCTATCGTTGGGAAGTCCTT
ATTATTGGTCCTCCAGATACACTTTATGAAGGTGGTGTTTTTAAGGCTCATCTCACTTTCCCAAAAGATT
ATCCCCTCCGGCCTCCTAAAATGAAATTCATTACAGAGATTTGGCACCCAAATGTTGATAAAAATGGTGA
TGTTTGCATTTCTATTCTTCATGAGCCTGGGGAGGATAAATATGGTTATGAGAAGCCAGAGGAACGCTGG
TTACCTATCCATACTGTGGAAACCATCATGATTAGTGTCATTTCTATGCTGGCAGATCCTAATGGAGACT
CACCTGCAAATGTAGATGCTGCGAAAGAATGGAGGGAAGACAGAAACGGAGAATTTAAAAGGAAAGTTGC
CCGCTGTGTAAGAAAAAGCCAAGAAACTGCTTTTGAGTGATGTATATTCAATAGTTAGTAACTTCACTTA
TTTCAGGGTCTCCAATTGAGAACA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 93454. Forward Primer - name:093454_F_cDNA_Ube2g1, sequence:TCAACACACATCTAGCTCCAGG; Reverse Primer - name:093454_N_SP6_cDNA_Ube2g1, sequence:TGTTCTCAATTGGAGACCCTG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20766 same embryo
 EMAGE:20765 same embryo
 EMAGE:20763 same embryo
 EMAGE:20767 same embryo
 EMAGE:20764 same embryo
 EurExpress:euxassay_014056 same experiment
 MGI:4829053 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS