Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:21039

Npy2r neuropeptide Y receptor Y2 ( MGI:108418)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:21039 EMAGE:21039 EMAGE:21039 EMAGE:21039 EMAGE:21039
"Pseudo-wholemount" of euxassay_008392. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_008392_01 euxassay_008392_02 euxassay_008392_03 euxassay_008392_04
EMAGE:21039 EMAGE:21039 EMAGE:21039 EMAGE:21039 EMAGE:21039
euxassay_008392_05 euxassay_008392_06 euxassay_008392_07 euxassay_008392_08 euxassay_008392_09
EMAGE:21039 EMAGE:21039 EMAGE:21039 EMAGE:21039 EMAGE:21039
euxassay_008392_10 euxassay_008392_11 euxassay_008392_12 euxassay_008392_13 euxassay_008392_14
EMAGE:21039 EMAGE:21039 EMAGE:21039 EMAGE:21039 EMAGE:21039
euxassay_008392_15 euxassay_008392_16 euxassay_008392_17 euxassay_008392_18 euxassay_008392_19
EMAGE:21039 EMAGE:21039 EMAGE:21039 EMAGE:21039
euxassay_008392_20 euxassay_008392_21 euxassay_008392_22 euxassay_008392_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:21039Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
21039_wholemount_strong.wlz
21039_wholemount_moderate.wlz
21039_wholemount_weak.wlz
21039_wholemount_possible.wlz
21039_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:21039_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
hypothalamus mantle layer
moderate moderate
single cellmoderate expression: see section 4 weak expression: see section 0 1 5
medulla oblongata basal plate mantle layer
weak weak
regionalweak expression: see section 9 5
trigeminal v ganglion
moderate moderate
single cellmoderate expression: see section 8 7 8 weak expression: see section 7
ventral grey horn
moderate moderate
single cellmoderate expression: see section 0 2 4 5
extrinsic ocular muscle
moderate moderate
regionalmoderate expression: see section 5 0 1 weak expression: see section 6 not examined expression: see section 0
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35270
Entity Detected:Npy2r, neuropeptide Y receptor Y2 ( MGI:108418)
Sequence:sense strand is shown

>T35270
CTCCTGAGAGCCACAGTAGGATCTGCATCCAGGCACACTGTGGACTCCATGGGCTCCCCTCATCACTTGA
TGAAAAGCTGCTAAACAACTCAGATTTCCCTAGGGAGCTACAGGCTCTCTGTTAGGGTGTTTTGGTTTTA
TTGTGTTTACCTAAGATGAAACCCAAATGAGAATGCTATAGGTAAACATGGCTTGCTACCTAAGGCGGTG
ACTTCAAGATAACGTCAAGAGAATAAACACATTGCTATACGAGTAATGTTTCGGCAATGATGGGAGAGAT
TCTAATATAATCAGTGAGCAATTAGTTGTTGTTCAGATCAAATGCACTACTGTTGAAAGTTTGTTTTTTA
GTTCAGAATCAAAATCTGAAATTATCATACTGAAAAGGAATGAAAACAATTGCTTTATTTCTGTAATAGC
CATTCCTGCTTAGGTAGATACTGTTTGGATGACAAGCGAGCAACTCAGCTCTTCTGTTTCTTGCTAACTG
CTAAAGCCTTTTGGAACCACACAACTTTTGTTACCATTCCTGCATGAGAGCAAACAAAGTTCAC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 98239. Forward Primer - name:098239_F_cDNA_Npy2r, sequence:CTCCTGAGAGCCACAGTAGGAT; Reverse Primer - name:098239_N_SP6_cDNA_Npy2r, sequence:GTGAACTTTGTTTGCTCTCATGC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_008392 same experiment
 EMAGE:21037 same embryo
 EMAGE:21038 same embryo
 EMAGE:21040 same embryo
 EMAGE:21041 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS