Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:21047

Gabra2 gamma-aminobutyric acid (GABA) A receptor, subunit alpha 2 ( MGI:95614)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:21047 EMAGE:21047 EMAGE:21047 EMAGE:21047 EMAGE:21047
"Pseudo-wholemount" of euxassay_008366. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_008366_01 euxassay_008366_02 euxassay_008366_03 euxassay_008366_04
EMAGE:21047 EMAGE:21047 EMAGE:21047 EMAGE:21047 EMAGE:21047
euxassay_008366_05 euxassay_008366_06 euxassay_008366_07 euxassay_008366_08 euxassay_008366_09
EMAGE:21047 EMAGE:21047 EMAGE:21047 EMAGE:21047 EMAGE:21047
euxassay_008366_10 euxassay_008366_11 euxassay_008366_12 euxassay_008366_13 euxassay_008366_14
EMAGE:21047 EMAGE:21047 EMAGE:21047 EMAGE:21047 EMAGE:21047
euxassay_008366_15 euxassay_008366_16 euxassay_008366_17 euxassay_008366_18 euxassay_008366_19
EMAGE:21047 EMAGE:21047 EMAGE:21047 EMAGE:21047 EMAGE:21047
euxassay_008366_20 euxassay_008366_21 euxassay_008366_22 euxassay_008366_23 euxassay_008366_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:21047Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
21047_wholemount_strong.wlz
21047_wholemount_moderate.wlz
21047_wholemount_weak.wlz
21047_wholemount_possible.wlz
21047_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:21047_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 9 weak expression: see section 7 8 0 5 6 7 8
diencephalon lateral wall marginal layer
moderate moderate
regionalmoderate expression: see section 9 weak expression: see section 7 8 0 5 6
telencephalon marginal layer
strong strong
regionalstrong expression: see section 4 7 8 9 0 1 moderate expression: see section 3 5 6 7 2 weak expression: see section 1 8 9 0 4 5 6 3 4
olfactory cortex marginal layer
strong strong
regionalstrong expression: see section 7 weak expression: see section 9 0 1 2 4 5 6
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35163
Entity Detected:Gabra2, gamma-aminobutyric acid (GABA) A receptor, subunit alpha 2 ( MGI:95614)
Sequence:sense strand is shown

>T35163
AGACTTGGTTACTTTTGGGCTGTATAGCAATGTTATACTTGGTTTTGGTTTTGGTTTTTGCTTTGTACAG
TCTGACTAATAACTGCTAATTTATGACCCACTATGTATAGTATGTATATATATATAATGGTAGAGCTTAC
AGTAGACCTCTAAAGGAGACCTGCATTTGCTAACTCATGGAAATACAGGCAGAAAACATCCCGTGCCAAA
AGAGCCATTGCCTTTTTAACACATTTACCTAGGAACTAGTTTAAAGTGGGTTTCAGATCCCATTATTTAT
TTCTTAATGTTCTAATTATAATGAAAGTCGGGATCCCATGTCACACTTTGGGAAACCTTTGATTTAGATA
TTACATAGAAAAATATTTCTACTGTTGCCTAAGGATGATCAGAGATTAATATTGCCACTCAAATATATGA
AACAGCCAAACCTCTGGCCTGGTTGCTTTAGGAGTGTTTAGAACCCCTGCTAGTGTCATTGGAAGC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 94004. Forward Primer - name:094004_F_cDNA_Gabra2, sequence:AGACTTGGTTACTTTTGGGCTG; Reverse Primer - name:094004_N_SP6_cDNA_Gabra2, sequence:GCTTCCAATGACACTAGCAGG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_008366 same experiment
 EMAGE:21042 same embryo
 EMAGE:21043 same embryo
 EMAGE:21044 same embryo
 EMAGE:21045 same embryo
 EMAGE:21046 same embryo
 EMAGE:6090 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS