Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:21078

Dhcr24 24-dehydrocholesterol reductase ( MGI:1922004)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:21078 EMAGE:21078 EMAGE:21078 EMAGE:21078 EMAGE:21078
"Pseudo-wholemount" of euxassay_011628. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011628_01 euxassay_011628_02 euxassay_011628_03 euxassay_011628_04
EMAGE:21078 EMAGE:21078 EMAGE:21078 EMAGE:21078 EMAGE:21078
euxassay_011628_05 euxassay_011628_06 euxassay_011628_07 euxassay_011628_08 euxassay_011628_09
EMAGE:21078 EMAGE:21078 EMAGE:21078 EMAGE:21078 EMAGE:21078
euxassay_011628_10 euxassay_011628_11 euxassay_011628_12 euxassay_011628_13 euxassay_011628_14
EMAGE:21078 EMAGE:21078 EMAGE:21078 EMAGE:21078 EMAGE:21078
euxassay_011628_15 euxassay_011628_16 euxassay_011628_17 euxassay_011628_18 euxassay_011628_19
EMAGE:21078 EMAGE:21078 EMAGE:21078 EMAGE:21078 EMAGE:21078
euxassay_011628_20 euxassay_011628_21 euxassay_011628_22 euxassay_011628_23 euxassay_011628_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:21078Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
21078_wholemount_strong.wlz
21078_wholemount_moderate.wlz
21078_wholemount_weak.wlz
21078_wholemount_possible.wlz
21078_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:21078_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
adrenal gland
weak weak
regionalweak expression: see section 9 0 1 8 9 0
thymus primordium
moderate moderate
regionalmoderate expression: see section 4 5 weak expression: see section 1 2 3
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 7 8 9 6 7 8 weak expression: see section 9
thyroid gland
moderate moderate
regionalmoderate expression: see section 0 1 2 5
vibrissa
moderate moderate
regionalmoderate expression: see section 4 5 6 7 0 1 2 3 weak expression: see section 3
hypothalamus ventricular layer
moderate moderate
regionalmoderate expression: see section 1 2 3 4
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 1 2 3 4
olfactory cortex ventricular layer
moderate moderate
homogeneousmoderate expression: see section 0 1 6 7
telencephalon ventricular layer
moderate moderate
homogeneousmoderate expression: see section 2 3 4 5 6 7 8 9 0 1 2 4 5 6 7 8 9 0 1 2 3
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 8 9 0 6 7
medulla oblongata basal plate ventricular layer
moderate moderate
regionalmoderate expression: see section 0 1 2 3 4 5 6 weak expression: see section 9 7
rest of cerebellum ventricular layer
moderate moderate
regionalmoderate expression: see section 0 1 2 weak expression: see section 5 6 7 9
pons mantle layer
moderate moderate
regionalmoderate expression: see section 7 8
not examined not examined
regionalnot examined expression: see section 1 2 3 4 5 6 7
pons ventricular layer
moderate moderate
regionalmoderate expression: see section 7 8 9 0 1 2 3 4 5 6 7 8 9 0
midbrain marginal layer
moderate moderate
regionalmoderate expression: see section 0 1 2 3 4 5 6 7 8
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 9 0 1 2 3 4 5 6 7 8
facial vii ganglion
strong strong
regionalstrong expression: see section 4 5 6 7 1 2
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 7 8 8 9
trigeminal v ganglion
strong strong
regionalstrong expression: see section 4 5 6 7 8 9 8 9 0 1 2 3 moderate expression: see section 3
vagus x ganglion
strong strong
regionalstrong expression: see section 9 7
trigeminal v nerve
strong strong
regionalstrong expression: see section 9 0 7
ventral grey horn
moderate moderate
regionalmoderate expression: see section 1 2 3 4 5 6 7
spinal cord ventricular layer
moderate moderate
regionalmoderate expression: see section 3 4
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 0 1 6 7
cervical ganglion
moderate moderate
regionalmoderate expression: see section 0
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 4 5
dorsal root ganglion
strong strong
regionalstrong expression: see section 8 9 0 1 2 7 8 9
pharyngo-tympanic tube
moderate moderate
regionalmoderate expression: see section 1 2 3 4 5 weak expression: see section 2 3 4
neural retina
moderate moderate
regionalmoderate expression: see section 1 2 3 4 3 4
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 8 9 weak expression: see section 0 1 2 4 5 6 7 8
nasal cavity respiratory epithelium
weak weak
regionalweak expression: see section 1 5
vomeronasal organ
weak weak
regionalweak expression: see section 1 4
stomach
strong strong
regionalstrong expression: see section 3 4 5 6 moderate expression: see section 2 7 8 9 0
hindgut
moderate moderate
regionalmoderate expression: see section 3 4 5
rectum
moderate moderate
regionalmoderate expression: see section 4
midgut
moderate moderate
regionalmoderate expression: see section 7 8 9 0 1 2 3 4 5 6 7
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 0 1 4 5
lower jaw molar
moderate moderate
regionalmoderate expression: see section 6 weak expression: see section 9
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 0 1 5 6
upper jaw molar
moderate moderate
regionalmoderate expression: see section 6 weak expression: see section 0
liver lobe
strong strong
regionalstrong expression: see section 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 moderate expression: see section 1 2 3 4
renal cortex
moderate moderate
regionalmoderate expression: see section 8 9 0 1 8 9 0 1 weak expression: see section 7
lung
moderate moderate
regionalmoderate expression: see section 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31046
Entity Detected:Dhcr24, 24-dehydrocholesterol reductase ( MGI:1922004)
Sequence:sense strand is shown

>T31046
CTGCGGTTTGAGCCTGTTCGGGGCCTGGAGGCCATCTGTGAAAAATTCACCCGCGAGTCCCAGCGGCTGG
AGAACCACTTCGTGGAAGGGTTGCTGTACTCCCTGGATGAGGCTGTCATCATGACAGGGGTCATGACGGA
CGACGTAGAGCCCAGCAAGCTGAATAGCATTGGCAGTTACTACAAGCCCTGGTTCTTCAAGCATGTGGAG
AACTACCTGAAGACAAACCGGGAGGGCCTCGAATACATTCCCCTGAGACACTACTACCACCGACACACGC
GCAGCATCTTCTGGGAGCTCCAGGACATCATCCCTTTCGGCAACAACCCCATCTTCCGCTACCTCTTCGG
CTGGATGGTGCCTCCCAAGATCTCCCTCCTGAAGCTGACCCAGGGCGAGACGCTACGCAAGCTGTACGAG
CAGCACCACGTGGTGCAGGACATGCTGGTGCCCATGAAGTGCATGTCACAGGCCCTGCATACCTTCCAAA
ATGACATCCACGTCTACCCCATCTGGCTGTGCCCATTCATCCTGCCCAGCCAGCCAGGACTAGTGCATCC
CAAGGGAGATGAAGCAGAGCTCTACGTGGACATCGGGGCATACGGGGAGCCACGTGTGAAGCACTTCGAG
GCCAGGTCCTGCATGAGGCAGCTGGAGAAGTTTGTGCGGAGTGTGCACGGGTTCCAAATGTTATACGCCG
ATTGCTATATGAACCGCGAGGAATTCTGGGAGATGTTCGATGGCTCCTTGTACCACAAGCTGCGCAAGCA
GCTGGGCTGCCAGGACGCCTTCCCTGAGGTGTACGACAAGATCTGCAAGGCG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:5054108), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 25726. Forward Primer - name:025726_F_IRAV36-39_L11_Dhcr24, sequence:CTGCGGTTTGAGCCTGTT; Reverse Primer - name:025726_R_SP6_IRAV36-39_L11_Dhcr24, sequence:CCGCCTTGCAGATCTTGT. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_011628 same experiment
 EMAGE:21079 same embryo
 EMAGE:21080 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS