Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:21079

Dcps decapping enzyme, scavenger ( MGI:1916555)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:21079 EMAGE:21079 EMAGE:21079 EMAGE:21079 EMAGE:21079
"Pseudo-wholemount" of euxassay_013612. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013612_01 euxassay_013612_02 euxassay_013612_03 euxassay_013612_04
EMAGE:21079 EMAGE:21079 EMAGE:21079 EMAGE:21079 EMAGE:21079
euxassay_013612_05 euxassay_013612_06 euxassay_013612_07 euxassay_013612_08 euxassay_013612_09
EMAGE:21079 EMAGE:21079 EMAGE:21079 EMAGE:21079 EMAGE:21079
euxassay_013612_10 euxassay_013612_11 euxassay_013612_12 euxassay_013612_13 euxassay_013612_14
EMAGE:21079 EMAGE:21079 EMAGE:21079 EMAGE:21079 EMAGE:21079
euxassay_013612_15 euxassay_013612_16 euxassay_013612_17 euxassay_013612_18 euxassay_013612_19
EMAGE:21079 EMAGE:21079 EMAGE:21079 EMAGE:21079 EMAGE:21079
euxassay_013612_20 euxassay_013612_21 euxassay_013612_22 euxassay_013612_23 euxassay_013612_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:21079Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
21079_wholemount_strong.wlz
21079_wholemount_moderate.wlz
21079_wholemount_weak.wlz
21079_wholemount_possible.wlz
21079_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:21079_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
adrenal medulla
moderate moderate
regionalmoderate expression: see section 9 0 8 9 weak expression: see section 1
diencephalon lateral wall mantle layer
strong strong
homogeneousstrong expression: see section 7 8 9 0 1 2 3 4 5 6 7 8 9
telencephalon mantle layer
strong strong
homogeneousstrong expression: see section 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4
medulla oblongata lateral wall
strong strong
homogeneousstrong expression: see section 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0
rest of cerebellum
strong strong
homogeneousstrong expression: see section 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3
pons
strong strong
homogeneousstrong expression: see section 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0
midbrain mantle layer
strong strong
homogeneousstrong expression: see section 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1
facial vii ganglion
strong strong
regionalstrong expression: see section 4 5 6 7 0 1 2
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 7 8 9 9 0
trigeminal v ganglion
strong strong
regionalstrong expression: see section 3 4 5 6 7 8 9 8 9 0 1 2 3
vagus x ganglion
strong strong
regionalstrong expression: see section 9 8
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 6 7 8 9 8 9 0
trigeminal v nerve
strong strong
regionalstrong expression: see section 9 0 7
spinal cord lateral wall
strong strong
homogeneousstrong expression: see section 0 1 2 3 4 5 6 7 8 9
cervico-thoracic ganglion
strong strong
regionalstrong expression: see section 0 1 2 3 6 7
cervical ganglion
strong strong
regionalstrong expression: see section 0 7
thoracic ganglion
strong strong
regionalstrong expression: see section 4 5
dorsal root ganglion
strong strong
regionalstrong expression: see section 8 9 0 1 2 3 4 7 8 9
saccule
strong strong
regionalstrong expression: see section 2 3 1 moderate expression: see section 2 3 4 weak expression: see section 4 7 8 9 7 8 9 0
neural retina
strong strong
regionalstrong expression: see section 1 2 3 4 3 4 moderate expression: see section 2
naris
strong strong
regionalstrong expression: see section 3 4
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 8 9 0 1 2 4 5 6 7 8 9
vomeronasal organ
strong strong
regionalstrong expression: see section 1 2 4 5
heart valve
moderate moderate
regionalmoderate expression: see section 1 2 3 4 weak expression: see section 0
stomach
strong strong
regionalstrong expression: see section 2 3 4 5 6 7 8 9 0
midgut
strong strong
regionalstrong expression: see section 7 8 9 0 1 2 3 4 5 6 7 8 9 0
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T214
Entity Detected:Dcps, decapping enzyme, scavenger ( MGI:1916555)
Sequence:sense strand is shown

>T214
GCATGGCGGATACAGCGCCTCAACTCAAGAGAAAGCGCGAACAGGAGGCAGAGGAGGCAGAAACCCCCAG
CACAGAGGAGAAGGAAGCAGGCGTTGGCAATGGCACCTCTGCCCCTGTCCGCTTACCGTTCTCCGGCTTT
AGAGTACAAAAAGTGCTCAGGGAGTCTGCGCGGGACAAAATTATTTTCCTGCATGGGAAGGTGAATGAGG
ACTCTGGGGATACTCATGGAGAAGATGCGGTTGTGATCCTGGAGAAGACACCATTTCAGGTAGAACACGT
GGCGCAGCTCCTAACGGGGAGCCCTGAGCTCAAGTTGCAGTTCTCCAATGATATCTACAGCACCTATAAC
CTGTTTCCTCCAAGGCATCTGAGTGATATAAAAACAACTGTGGTGTACCCTGCCACAGAGAAACACCTGC
AAAAATACATGCGTCAGGACCTCCGCCTGATCCGAGAGACTGGAGATGACTACAGGACCATCACCTTACC
CTACCTGGAATCCCAGAGCC
Notes:The probe template was PCR amplified from IMAGE:2649015 using vector specific primers. Forward Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2649015 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_013612 same experiment
 EMAGE:21078 same embryo
 EMAGE:21080 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS