Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:21203

Dad1 defender against cell death 1 ( MGI:101912)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:21203 EMAGE:21203 EMAGE:21203 EMAGE:21203 EMAGE:21203
euxassay_012117_01 euxassay_012117_02 euxassay_012117_03 euxassay_012117_04 euxassay_012117_05
EMAGE:21203 EMAGE:21203 EMAGE:21203 EMAGE:21203 EMAGE:21203
euxassay_012117_06 euxassay_012117_07 euxassay_012117_08 euxassay_012117_09 euxassay_012117_10
EMAGE:21203 EMAGE:21203 EMAGE:21203 EMAGE:21203 EMAGE:21203
euxassay_012117_11 euxassay_012117_12 euxassay_012117_13 euxassay_012117_14 euxassay_012117_15
EMAGE:21203 EMAGE:21203 EMAGE:21203 EMAGE:21203 EMAGE:21203
euxassay_012117_16 euxassay_012117_17 euxassay_012117_18 euxassay_012117_19 euxassay_012117_20
EMAGE:21203 EMAGE:21203 EMAGE:21203 EMAGE:21203
euxassay_012117_21 euxassay_012117_22 euxassay_012117_23 euxassay_012117_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:21203Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
21203_wholemount_strong.wlz
21203_wholemount_moderate.wlz
21203_wholemount_weak.wlz
21203_wholemount_possible.wlz
21203_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:21203_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
strong strong
regionalstrong expression: see section 1 2 3 4 5 6 7 8 9 0 4 5 6 7 8 9 0 1 2
radius
strong strong
regionalstrong expression: see section 1
humerus
strong strong
regionalstrong expression: see section 1 2 3 9 0 1
fibula
strong strong
regionalstrong expression: see section 2 3 4
tibia
strong strong
regionalstrong expression: see section 2 3 4
femur
strong strong
regionalstrong expression: see section 1 2 3 4 5 6 7 8
otic capsule
strong strong
regionalstrong expression: see section 7 8 4 5
naris
strong strong
regionalstrong expression: see section 2 3 4 5 6 7 8
nasal septum
strong strong
regionalstrong expression: see section 4
nose
strong strong
regionalstrong expression: see section 9 0 1 2 5 9 0 1
meckel's cartilage
strong strong
regionalstrong expression: see section 2 3 4 5 6 7 8 9 0 1 2 3 4 8
axial skeleton
strong strong
regionalstrong expression: see section 5 6 7 8 9 0 1 2 3 4
basioccipital bone
strong strong
regionalstrong expression: see section 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4
basisphenoid bone
strong strong
regionalstrong expression: see section 5 6 7 8 9 0 1 2 3 4 5
temporal bone petrous part
strong strong
regionalstrong expression: see section 1 2 3 7 8 9 0 1 2 3
vault of skull
strong strong
regionalstrong expression: see section 1 3 4
orbito-sphenoid
strong strong
regionalstrong expression: see section 1 2 3 4 5 6 7 8 9 9 0 1 2 3
scapula
strong strong
regionalstrong expression: see section 2 9
pelvic girdle skeleton
strong strong
regionalstrong expression: see section 9 0 6
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30720
Entity Detected:Dad1, defender against cell death 1 ( MGI:101912)
Sequence:sense strand is shown

>T30720
AAGTCCCCGTGTTCGTCATGTCGGCGTCTGTGGTGTCCGTCATCTCCCGGTTCCTGGAGGAGTACTTGAG
CTCCACTCCGCAGCGGCTGAAGTTGCTGGACGCCTATCTCCTTTATATACTGCTGACCGGGGCGCTGCAG
TTCGGCTACTGTCTCCTCGTGGGCACCTTCCCCTTCAACTCTTTCCTCTCTGGCTTCATCTCTTGTGTGG
GCAGCTTCATCCTAGCGGTTTGCCTGAGAATACAGATCAACCCCCAGAACAAGGCGGACTTCCAAGGCAT
CTCTCCGGAGCGAGCCTTTGCTGACTTCCTCTTTGCCAGCACGATCCTGCACCTTGTCGTCATGAACTTC
GTTGGCTGAACTCCGTCTCCTTACCGTGGAGTTGGAGGTTGGCGGAGCGCTCACTCTTTGACGTCCCCTG
GATCAGCATTCTTGAGCTGGCAGCTTGTTGCACATGGCTTCTTCAGATTCGTGCTTGACTACGAGTCTCA
CTGGTTGTGAGGTGGCACGTCCAGAGAACTCCCTTCGCTCTATCGG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:5683424), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 60353. Forward Primer - name:060353_F_IRAV119_h05_Dad1, sequence:AAGTCCCCGTGTTCGTCA; Reverse Primer - name:060353_R_SP6_IRAV119_h05_Dad1, sequence:TCCGATAGAGCGAAGGGA. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_012117 same experiment
 EMAGE:21202 same embryo
 EMAGE:21204 same embryo
 EMAGE:21205 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS