Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:21213

Peli2 pellino 2 ( MGI:1891445)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:21213 EMAGE:21213 EMAGE:21213 EMAGE:21213 EMAGE:21213
euxassay_014344_01 euxassay_014344_02 euxassay_014344_03 euxassay_014344_04 euxassay_014344_05
EMAGE:21213 EMAGE:21213 EMAGE:21213 EMAGE:21213 EMAGE:21213
euxassay_014344_06 euxassay_014344_07 euxassay_014344_08 euxassay_014344_09 euxassay_014344_10
EMAGE:21213 EMAGE:21213 EMAGE:21213 EMAGE:21213 EMAGE:21213
euxassay_014344_11 euxassay_014344_12 euxassay_014344_13 euxassay_014344_14 euxassay_014344_15
EMAGE:21213 EMAGE:21213 EMAGE:21213 EMAGE:21213 EMAGE:21213
euxassay_014344_16 euxassay_014344_17 euxassay_014344_18 euxassay_014344_19 euxassay_014344_20
EMAGE:21213 EMAGE:21213 EMAGE:21213 EMAGE:21213
euxassay_014344_21 euxassay_014344_22 euxassay_014344_23 euxassay_014344_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:21213Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
21213_wholemount_strong.wlz
21213_wholemount_moderate.wlz
21213_wholemount_weak.wlz
21213_wholemount_possible.wlz
21213_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:21213_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
strong strong
regionalstrong expression: see section 2 3 4 5 6 7 8 9 0 1 2 6 7 8 9 0 1 2 3 4
radius
strong strong
regionalstrong expression: see section 1 2
humerus
strong strong
regionalstrong expression: see section 1 2 3 4 5 6 3 4
forelimb digit 2 phalanx
strong strong
regionalstrong expression: see section 4
hindlimb digit 2 phalanx
strong strong
regionalstrong expression: see section 6
hindlimb digit 3 phalanx
strong strong
regionalstrong expression: see section 6 0 1
hindlimb digit 4 phalanx
strong strong
regionalstrong expression: see section 6 0 1
hindlimb digit 5 phalanx
strong strong
regionalstrong expression: see section 0 1
fibula
strong strong
regionalstrong expression: see section 1 2 3 4 2 3 4
tibia
strong strong
regionalstrong expression: see section 1 2 3 4 2 3 4
femur
strong strong
regionalstrong expression: see section 1 2 3 4 5 6 7 8 8 9 0 1 2 3 4
otic capsule
strong strong
regionalstrong expression: see section 7 8 9 0 1 7 8 9
nasal septum
strong strong
regionalstrong expression: see section 3
nose
strong strong
regionalstrong expression: see section 7 8 9 0 1 2 4 5 6 7 8 9
hyoid
strong strong
regionalstrong expression: see section 1 2 3 4 5 6 7
meckel's cartilage
strong strong
regionalstrong expression: see section 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3
axial skeleton
strong strong
regionalstrong expression: see section 9 0 1 2 3 4 5 6 7 8 9 0
basioccipital bone
strong strong
regionalstrong expression: see section 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4
basisphenoid bone
strong strong
regionalstrong expression: see section 0 1 2 3 4 5 6 7 8
temporal bone petrous part
strong strong
regionalstrong expression: see section 2 3 4 5 6 7 0 1 2 3 4
vault of skull
strong strong
regionalstrong expression: see section 1 2
orbito-sphenoid
strong strong
regionalstrong expression: see section 2 3 4 5 6 7 8 9 0 1 2 3 4
clavicle
strong strong
regionalstrong expression: see section 7 8 9 0 1 2
scapula
strong strong
regionalstrong expression: see section 4 5 6 3 4
pelvic girdle skeleton
strong strong
regionalstrong expression: see section 9 0 6 7
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31518
Entity Detected:Peli2, pellino 2 ( MGI:1891445)
Sequence:sense strand is shown

>T31518
CCACAAACACCACCAGCATAGCCTCAGGCAGCAGGCCTGACAAGGACATCAACGTGGTCTCCTGTGGTAA
CATGCACCTTGGAGATGGACATGGCCTCCAGTGGGGGCACAGACCACAGACATGCTCACCAGCCCACATA
GCAGCATGGACAGTGGATATCACTGTGGCCTCAGATGATAGCAAGACAAACCATGGAGATCATCATAGCC
TCTGGCAGCAGCACGGATCACAGACACCAGTGTTGTCTCCAGCAGCAGCAGGAACCTCGGAAGTCTTTCC
AGGAGGCTTACCCCAGAAAATGAACCATTCTTCATTTCAGGCCATCAGCTCCAGAGGACATCACAGCATA
TCGTACACGTTGTCACGGAGCCAGACGGTAGTGGTGGAGTACACACACGATAAAGACACGGACATGTTTC
AGGTGGGCAGGTCAACAGAAAGCCCCATTGACTTCGTGGTCACAGACACGGTTTCCGGCGGTCAGAACGA
AGATGCCCAGATCACACAGAGCACCATCTCTAGGTTCGCATGCAGGATCGTGTGTGACAGGAACGAGCCA
TACACAGCACGCATATTTGCGGCAGGATTCGATTCT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:5355240), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 31859. Forward Primer - name:031859_F_IRAV63-66_P20_Peli2, sequence:CCACAAACACCACCAGCA; Reverse Primer - name:031859_R_SP6_IRAV63-66_P20_Peli2, sequence:AAGAATCGAATCCTGCCG. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_014344 same experiment
 EMAGE:21212 same embryo
 EMAGE:21214 same embryo
 EMAGE:21215 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS