Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:21297

Prrc2b proline-rich coiled-coil 2B ( MGI:1923304)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:21297 EMAGE:21297 EMAGE:21297 EMAGE:21297 EMAGE:21297
euxassay_012252_01 euxassay_012252_02 euxassay_012252_03 euxassay_012252_04 euxassay_012252_05
EMAGE:21297 EMAGE:21297 EMAGE:21297 EMAGE:21297 EMAGE:21297
euxassay_012252_06 euxassay_012252_07 euxassay_012252_08 euxassay_012252_09 euxassay_012252_10
EMAGE:21297 EMAGE:21297 EMAGE:21297 EMAGE:21297 EMAGE:21297
euxassay_012252_11 euxassay_012252_12 euxassay_012252_13 euxassay_012252_14 euxassay_012252_15
EMAGE:21297 EMAGE:21297 EMAGE:21297 EMAGE:21297 EMAGE:21297
euxassay_012252_16 euxassay_012252_17 euxassay_012252_18 euxassay_012252_19 euxassay_012252_20

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:21297Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
21297_wholemount_strong.wlz
21297_wholemount_moderate.wlz
21297_wholemount_weak.wlz
21297_wholemount_possible.wlz
21297_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:21297_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
cerebral cortex marginal layer
moderate moderate
regionalmoderate expression: see section 5 6 7 8 9 0 weak expression: see section 1 2 3 4 5 6 7 8 9 0 3 4
olfactory cortex marginal layer
moderate moderate
regionalmoderate expression: see section 5 weak expression: see section 7 8 9 0 3 4
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 6 7 3
pons mantle layer
moderate moderate
regionalmoderate expression: see section 5 weak expression: see section 5
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 6 7 0 1 weak expression: see section 8 9 2 3
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 2 3 7 8
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 4 5 5 6
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 1 2 3 4 5 6 5 6 7 8 9
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 6 4
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 4 5 6 5 6
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 5 weak expression: see section 7
ventral grey horn
moderate moderate
regionalmoderate expression: see section 8 weak expression: see section 9 0 1 2 3 4 5
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 5 6 7 8 9 0 1 3 4 5 6
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 9 0 2 3 4 moderate expression: see section 6 7 8 5 6
vomeronasal organ
strong strong
regionalstrong expression: see section 0 3
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30390
Entity Detected:Prrc2b, proline-rich coiled-coil 2B ( MGI:1923304)
Sequence:sense strand is shown

>T30390
TCTCGCATCCCTCCTCAGAAGCACTGTCCACTTAGGAGTCCCCAGCACAGATCTGCCTGTGCCCCTATCA
GCCCTTCCACCCCCCGGAAGTGACCGAGTCCTCTGCCCCACTGCCAAGCTCTACCCCATAAGTCTCACTC
AGTAAAAGCCACACAGTCACCTCTTAGAAATGCGGCCAGACCCACCTCACCCAATGCTTGGTGGGCATTA
TGTGTCAAAAGAAGCAAACATTTTTCTCTTTCAGAATTTCACAGGATGCTGTTACAAACTCAAAATGTGC
CCTTTAGGTGAGCCTGCTGTCAGAATGGCAGTACTCCCTGTTTTAAGAAGAAAAATTAGGAGGTCACCTG
TTTTCAGTCCTTTCTCTAACCCTGTATTTCCCTCCTGCCTCCCACCCTAAATAAAAACAAGAAACACTAG
AATTTATTTATATGTATTGATGTTGTAGGTCTAGATGGAAAAAAAAAAGTAAATGTCCCACTGCTCTGTT
TATATAATGTCTGAATTACTCTGTGCAGGAAAGGCCAGGAAATTGCATGTGAAATTTGGTGTGCTCACCA
CCTCTGTGATCTCAGCTGTGGGCTCTACCCCTCTGAGAGGCACATTTGCAACTAGACGCTGAGGACAGAG
GGCAGGCTTCAGGCCAAATGTCCCTACTCCTCGGATGATCTGGTCAAGCCAAGTTTTTAGTACAGAGGTG
TTTTAAGGTGCAATATCTCTTTGTGTGGTTTTTAGAGTCAAGCTCAAAGTATAATAGAACTTGGGCCTTA
TTTTGGTTTCAAACCCCCATCTTTAGATCACACATAAAAACAGGAGCGTCTGTCAGGGTGCCATGGCCTT
TGGTGGGAACAGGTAAAGTCCAGCCCTGCCTTTTCTACTGCTGAGATGGGTGGAGGTGGGCAGAATCTTT
TACTCCTGCCTGCTGAAGTCACCTCCTACTGCTGGTGGCTTTGTTGGTGCCACTGATG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:6329995), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 58575. Forward Primer - name:058575_F_IRAV102_h02_5830434P21Rik, sequence:TCTCGCATCCCTCCTCAG; Reverse Primer - name:058575_R_SP6_IRAV102_h02_5830434P21Rik, sequence:CCATCAGTGGCACCAACA. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_012252 same experiment
 EMAGE:21298 same embryo
 EMAGE:21299 same embryo
 EMAGE:21300 same embryo
 EMAGE:21301 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS