Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:21312

Rarg retinoic acid receptor, gamma ( MGI:97858)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:21312 EMAGE:21312 EMAGE:21312 EMAGE:21312 EMAGE:21312
euxassay_000059_01 euxassay_000059_02 euxassay_000059_03 euxassay_000059_04 euxassay_000059_05
EMAGE:21312 EMAGE:21312 EMAGE:21312 EMAGE:21312 EMAGE:21312
euxassay_000059_06 euxassay_000059_07 euxassay_000059_08 euxassay_000059_09 euxassay_000059_10
EMAGE:21312 EMAGE:21312 EMAGE:21312 EMAGE:21312 EMAGE:21312
euxassay_000059_11 euxassay_000059_12 euxassay_000059_13 euxassay_000059_14 euxassay_000059_15
EMAGE:21312 EMAGE:21312 EMAGE:21312 EMAGE:21312 EMAGE:21312
euxassay_000059_16 euxassay_000059_17 euxassay_000059_18 euxassay_000059_19 euxassay_000059_20
EMAGE:21312 EMAGE:21312 EMAGE:21312 EMAGE:21312
euxassay_000059_21 euxassay_000059_22 euxassay_000059_23 euxassay_000059_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:21312Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
21312_wholemount_strong.wlz
21312_wholemount_moderate.wlz
21312_wholemount_weak.wlz
21312_wholemount_possible.wlz
21312_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:21312_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
strong strong
regionalstrong expression: see section 1 2 3 5 6 7 8 9 1 moderate expression: see section 4 0 2 3 5 6 8 9 0 1 2 3 4
shoulder joint primordium
moderate moderate
regionalmoderate expression: see section 3
humerus
moderate moderate
regionalmoderate expression: see section 1 2 2 3 4
foot
moderate moderate
regionalmoderate expression: see section 4
hindlimb digit 1 metatarsal
moderate moderate
regionalmoderate expression: see section 4
hindlimb digit 2 metatarsal
moderate moderate
regionalmoderate expression: see section 4
hindlimb digit 3 metatarsal
moderate moderate
regionalmoderate expression: see section 4
hindlimb digit 4 metatarsal
moderate moderate
regionalmoderate expression: see section 4
fibula
moderate moderate
regionalmoderate expression: see section 1 2 3 4
tibia
moderate moderate
regionalmoderate expression: see section 1 2 3 4
femur
moderate moderate
regionalmoderate expression: see section 1 2 3 4 5 6 7 8 2 3 4 weak expression: see section 9 1
pons mantle layer
moderate moderate
regionalmoderate expression: see section 8
heart
moderate moderate
spottedmoderate expression: see section 8 9 0 1 weak expression: see section 2 3
mitral valve
moderate moderate
regionalmoderate expression: see section 4 5
tricuspid valve
moderate moderate
regionalmoderate expression: see section 1 2 3 4 5
esophagus
strong strong
regionalstrong expression: see section 9 1 moderate expression: see section 8 3 4 5 weak expression: see section 2
stomach
strong strong
regionalstrong expression: see section 4 moderate expression: see section 3 5 6 7 weak expression: see section 2
mandible
moderate moderate
regionalmoderate expression: see section 1 2 3 weak expression: see section 4
meckel's cartilage
moderate moderate
regionalmoderate expression: see section 3 7 3 weak expression: see section 4 6 8 9
maxilla
weak weak
regionalweak expression: see section 4
lung
moderate moderate
spottedmoderate expression: see section 8 9 0 1 3 5 6 7 9 0 1 3 4 weak expression: see section 4 5 6 7 2 4 8
right lung
strong strong
regionalstrong expression: see section 3 4 5 6 7 8 9 0 1
cervical vertebra
strong strong
regionalstrong expression: see section 9 1 moderate expression: see section 8 0 2 3 4 5 6 7 8 9
lumbar vertebra
strong strong
regionalstrong expression: see section 1 moderate expression: see section 0 2 3 4 5 6 7 8 9 0
sacral vertebral cartilage condensation
strong strong
regionalstrong expression: see section 1 moderate expression: see section 2 3 4 5 6 7 8 9 0
thoracic vertebra
strong strong
regionalstrong expression: see section 9 1 moderate expression: see section 0 2 3 4 5 6 7 8 9 0
cranium
moderate moderate
regionalmoderate expression: see section 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4
not examined not examined
othernot examined expression: see section 4 5
not examined not examined
regionalnot examined expression: see section 8
not examined not examined
regionalnot examined expression: see section 5 6 7 8
not examined not examined
regionalnot examined expression: see section 1 2 3 4 5 6 8 9
not examined not examined
regionalnot examined expression: see section 3 4 5 6 7 8 9 0 1
not examined not examined
regionalnot examined expression: see section 6 7
not examined not examined
regionalnot examined expression: see section 6 7 8 1
not examined not examined
regionalnot examined expression: see section 5 6 7
not examined not examined
regionalnot examined expression: see section 7
viscerocranium
moderate moderate
regionalmoderate expression: see section 8 not examined expression: see section 9 0 1
clavicle
strong strong
regionalstrong expression: see section 0 moderate expression: see section 4 5 9 1 6 7 9 3 weak expression: see section 3 6 7 8
scapula
moderate moderate
regionalmoderate expression: see section 3 4 5 1 2 3 5 8 4
pelvic girdle skeleton
moderate moderate
regionalmoderate expression: see section 0 1 9 0
axial skeleton tail region
moderate moderate
regionalmoderate expression: see section 5 6 weak expression: see section 4
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1626
Entity Detected:Rarg, retinoic acid receptor, gamma ( MGI:97858)
Sequence:sense strand is shown

>T1626
TGGCCTCGAGCCAGAATTCGGACGAGGATTCCAGGCCCGATGCCACCCCTGATCCGAGAGATGCTGGAGA
ACCCGGAGATGTTTGAGGACGACTCCTCGAAGCCTGGCCCCCACCCCAAGGCTTCCAGTGAGGACGAAGC
TCCAGGGGGCCAGGGCAAAAGGGGCCAAAGTCCCCAACCTGACCAGGGGCCCTGACCTACCCCGTTGTGG
GGTTGGGCCCCAGGCAGCAGACTGACCATTTCCCAGATACCGCCAGTGACTGGGGGAGGACCTGCCCCGC
CCACTCTCCACCCTTTTAATGAGCTCGTTATTTTGCCAAAGTTTCTAGGGGTGCCTGTGTTCATCCCTGT
CCTGTTCTAACTGGCTCCCTCTACAGTCCCGCGGGACTGCTGCACACCTACCAGAAGAGCTGGAGAAGGG
GCGAGCCTGGGTCTAGACTCTAAAATCTCAGCACTGCCTTTCGGATTCAGGCCACAGGCTCCCGACGCAA
GAGGAAGCCCCGCCTTCCCATAGCCTTTTCCTCTGCCAGGTGCTTGGGCCTCTGGGAGCAAACAGGAACA
CTAGAGA
Notes:The probe template was PCR amplified from IMAGE:439731 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:439731 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000059 same experiment
 EMAGE:21313 same embryo
 EMAGE:21310 same embryo
 EMAGE:21311 same embryo
 EMAGE:21314 same embryo
 EMAGE:21315 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS