Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:21453

Serpina10 serine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10 ( MGI:2667725)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:21453 EMAGE:21453 EMAGE:21453 EMAGE:21453 EMAGE:21453
"Pseudo-wholemount" of euxassay_000857. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000857_01 euxassay_000857_02 euxassay_000857_03 euxassay_000857_04
EMAGE:21453 EMAGE:21453 EMAGE:21453 EMAGE:21453 EMAGE:21453
euxassay_000857_05 euxassay_000857_06 euxassay_000857_07 euxassay_000857_08 euxassay_000857_09
EMAGE:21453 EMAGE:21453 EMAGE:21453 EMAGE:21453 EMAGE:21453
euxassay_000857_10 euxassay_000857_11 euxassay_000857_12 euxassay_000857_13 euxassay_000857_14
EMAGE:21453 EMAGE:21453 EMAGE:21453 EMAGE:21453 EMAGE:21453
euxassay_000857_15 euxassay_000857_16 euxassay_000857_17 euxassay_000857_18 euxassay_000857_19
EMAGE:21453 EMAGE:21453 EMAGE:21453 EMAGE:21453 EMAGE:21453
euxassay_000857_20 euxassay_000857_21 euxassay_000857_22 euxassay_000857_23 euxassay_000857_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:21453Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
21453_wholemount_strong.wlz
21453_wholemount_moderate.wlz
21453_wholemount_weak.wlz
21453_wholemount_possible.wlz
21453_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:21453_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
liver lobe
moderate moderate
homogeneousmoderate expression: see section 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 7 8 9 0 1 2 3 4
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T931
Entity Detected:Serpina10, serine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10 ( MGI:2667725)
Sequence:sense strand is shown

>T931
TCTCGAGNCTGTTGGCCTACTGGGCTCTGAATGATCTTCTCGGCACCAGAGGTCCAGGACTGGATGAAGG
GAAGTGGCCCCTGGCCTCCACAGCTGACCACATGAGGGTGGCTTCTAGCCTCTTTCTTCCTGTCCTCCTG
ACAGAGGTGTGGCTGGTGACTAGTTTCAATCTCAGCTCCCATTCACCAGAGGCTTCCGTTCACCTGGAGT
CTCAGGATTATGAGAATCAAACCTGGGAAGAGTACACACGGACTGATCCCAGGGAGGAGGAGGAGGAGGA
GGAGGAAAAGGAGGAAGGCAAGGATGAGGAATATTGGCTGAGGGCCAGTCAGCAGCTCTCCAATGAGACT
TCAAGCTTTGGGTTCAACCTGCTTCGAAAGATCTCCATGAGGCACGACGGCAATGTGATCTTCTCACCTT
TTGGCCTGTCTGTGGCCATGGTGAATTTGATGCTGGGGACCAAGGGAGAGACCAAAGTCCAGATAGAAAA
TGGACTCAACCTACAGGCCCTGAGCCAAGCAGGACCCCTGATCCTTCCAGCCCTCTTCA
Notes:The probe template was PCR amplified from IMAGE:1925166 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1925166 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000857 same experiment
 EMAGE:21451 same embryo
 EMAGE:21450 same embryo
 EMAGE:21454 same embryo
 EMAGE:21455 same embryo
 EMAGE:21452 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS