Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:21455

Faah fatty acid amide hydrolase ( MGI:109609)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:21455 EMAGE:21455 EMAGE:21455 EMAGE:21455 EMAGE:21455
euxassay_000880_01 euxassay_000880_02 euxassay_000880_03 euxassay_000880_04 euxassay_000880_05
EMAGE:21455 EMAGE:21455 EMAGE:21455 EMAGE:21455 EMAGE:21455
euxassay_000880_06 euxassay_000880_07 euxassay_000880_08 euxassay_000880_09 euxassay_000880_10
EMAGE:21455 EMAGE:21455 EMAGE:21455 EMAGE:21455 EMAGE:21455
euxassay_000880_11 euxassay_000880_12 euxassay_000880_13 euxassay_000880_14 euxassay_000880_15
EMAGE:21455 EMAGE:21455 EMAGE:21455 EMAGE:21455 EMAGE:21455
euxassay_000880_16 euxassay_000880_17 euxassay_000880_18 euxassay_000880_19 euxassay_000880_20
EMAGE:21455 EMAGE:21455 EMAGE:21455
euxassay_000880_21 euxassay_000880_22 euxassay_000880_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:21455Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
21455_wholemount_strong.wlz
21455_wholemount_moderate.wlz
21455_wholemount_weak.wlz
21455_wholemount_possible.wlz
21455_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:21455_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
medulla oblongata basal plate
moderate moderate
homogeneousmoderate expression: see section 1 7
inferior glossopharyngeal ix ganglion
weak weak
homogeneousweak expression: see section 8 0 not examined expression: see section 9
trigeminal v ganglion
weak weak
homogeneousweak expression: see section 5 6 7 9 8 9 0 1 2 3
vagus x ganglion
weak weak
regionalweak expression: see section 9 0 8 9
vestibulocochlear viii ganglion
weak weak
homogeneousweak expression: see section 9
vestibulocochlear viii ganglion cochlear component
weak weak
homogeneousweak expression: see section 7 8 9 0
vestibulocochlear viii ganglion vestibular component
weak weak
homogeneousweak expression: see section 7 8 9 0 1
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 9 0 1 2 5 6 7 8 9 weak expression: see section 8
midgut loop
moderate moderate
regionalmoderate expression: see section 8 9 0 1 2 3 4 5 6
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T924
Entity Detected:Faah, fatty acid amide hydrolase ( MGI:109609)
Sequence:sense strand is shown

>T924
TCCTCAGNCTGTTGGCCTACTGGGGATCGCGGGCGATCCAGGCCGGGTTTTGCAGCGGAGCTGTTGGTGT
GCGCGTGCCGAGTCCTCTCGGGTGGCGGTCGGCTGCAGGAGATCATGGTGCTGAGCGAAGTGTGGACCGC
GCTGTCTGGACTCTCCGGGGTTTGCCTAGCCTGCAGCTTGCTGTCGGCGGCGGTGGTCCTGCGATGGACC
AGGAGCCAGACCGCCCGGGGCGCGGTGACCAGGGCGCGGCAGAAGCAGCGAGCCGGCCTGGAGACCATGG
ACAAGGCGGTGCAGCGCTTCCGGCTGCAGAATCCTGACCTGGATTCAGAGGCCTTGCTGGCTCTGCCCCT
GCTCCAACTGGTACAGAAGTTACAGAGTGGGGAACTGTCCCCAGAAGCTGTGCTCTTTACCTACCTGGGA
AAGGCCTGGGAAGTGAACAAAGGGACCAACTGTGTGACCTCCTATCTGACTGACTGTGAGACTCAGCTGT
CCCAGGCCCCACGGCAGGGCCTGCTCTATGGCGTCCCCGTGAGCCTCAAGG
Notes:The probe template was PCR amplified from IMAGE:1925032 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1925032 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000880 same experiment
 EMAGE:21453 same embryo
 EMAGE:21451 same embryo
 EMAGE:21450 same embryo
 EMAGE:21454 same embryo
 EMAGE:21452 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS