Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:21580

Psma3 proteasome (prosome, macropain) subunit, alpha type 3 ( MGI:104883)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:21580 EMAGE:21580 EMAGE:21580 EMAGE:21580 EMAGE:21580
euxassay_001254_01 euxassay_001254_02 euxassay_001254_03 euxassay_001254_04 euxassay_001254_05
EMAGE:21580 EMAGE:21580 EMAGE:21580 EMAGE:21580 EMAGE:21580
euxassay_001254_06 euxassay_001254_07 euxassay_001254_08 euxassay_001254_09 euxassay_001254_10
EMAGE:21580 EMAGE:21580 EMAGE:21580 EMAGE:21580 EMAGE:21580
euxassay_001254_11 euxassay_001254_12 euxassay_001254_13 euxassay_001254_14 euxassay_001254_15
EMAGE:21580 EMAGE:21580 EMAGE:21580 EMAGE:21580 EMAGE:21580
euxassay_001254_16 euxassay_001254_17 euxassay_001254_18 euxassay_001254_19 euxassay_001254_20

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:21580Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
21580_wholemount_strong.wlz
21580_wholemount_moderate.wlz
21580_wholemount_weak.wlz
21580_wholemount_possible.wlz
21580_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:21580_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
axial musculature
moderate moderate
regionalmoderate expression: see section 2 3 4 5 6 7 8 9 0
thymus primordium
moderate moderate
homogeneousmoderate expression: see section 9 0 1 2 3
submandibular gland primordium
weak weak
regionalweak expression: see section 4 5 6 7 8 5 6 7 8
pancreas
weak weak
regionalweak expression: see section 6 7 8 9 0 1
vibrissa
weak weak
regionalweak expression: see section 2 3 4 5 7 8 9 0
telencephalon marginal layer
weak weak
regionalweak expression: see section 1 2 3 4 5 6 7 8 9 2 3 4 5 6 7 8 9 0
olfactory cortex marginal layer
weak weak
regionalweak expression: see section 7 8 9 2 3 4 5
olfactory cortex ventricular layer
weak weak
regionalweak expression: see section 0 1
telencephalon ventricular layer
weak weak
regionalweak expression: see section 1 2 3 4 5 6 7 8 9 2 3 4 5 6 7 8 9 0
medulla oblongata alar plate mantle layer
moderate moderate
regionalmoderate expression: see section 5
medulla oblongata alar plate ventricular layer
moderate moderate
regionalmoderate expression: see section 9 0
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 6 7 3 4
pons mantle layer
moderate moderate
regionalmoderate expression: see section 4 weak expression: see section 4 5
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 4 5 6 7 8 9 0 1 2 3
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 4
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 1 2 8 9
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 4 6
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 1 2 3 4 5 6 5 6 7 8 9 0
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 5 6 5
ventral grey horn
weak weak
regionalweak expression: see section 8 9 2 3 4 5
intermediate grey horn
weak weak
regionalweak expression: see section 3
lower jaw incisor
weak weak
regionalweak expression: see section 9 0 2 3 4 5
lower jaw molar
weak weak
regionalweak expression: see section 4 5 6 7 5 6 7 8
upper jaw incisor
weak weak
regionalweak expression: see section 9 0 3 4 5
upper jaw molar
weak weak
regionalweak expression: see section 4 5 6 7 5 6 7 8
renal cortex
moderate moderate
regionalmoderate expression: see section 5 6 7 8 9 6 7 8 9 0
left lung
moderate moderate
regionalmoderate expression: see section 2 3 4 5 6 7 8 9 0 not examined expression: see section 1 2
right lung
moderate moderate
regionalmoderate expression: see section 0 1 2 3 4 5 6 7 8 9 0
chondrocranium
moderate moderate
regionalmoderate expression: see section 1 2 3 8 9 0
tail dorsal root ganglion
weak weak
regionalweak expression: see section 7 8 9 0 4 5 6
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T4701
Entity Detected:Psma3, proteasome (prosome, macropain) subunit, alpha type 3 ( MGI:104883)
Sequence:sense strand is shown

>T4701
GCCGGGTCAGCACCATGAGCTCCATCGGCACTGGGTATGACTTGTCAGCCTCTACGTTCTCTCCTGATGG
AAGAGTTTTCCAAGTTGAATATGCCATGAAGGCTGTGGAAAACAGTAGTACAGCTATTGGGATCAGATGT
AAAGATGGTGTTGTGTTTGGGGTAGAAAAACTAGTCCTTTCTAAACTTTATGAAGAAGGCTCCAATAAAC
GTCTTTTTAATGTTGATCGACATGTTGGAATGGCAGTTGCAGGTTTGCTGGCAGATGCTCGTTCATTAGC
AGACATAGCGAGAGAAGAAGCATCCAACTTTAGGTCCAACTTCGGCTATAACATTCCTCTAAAACATCTT
GCAGACAGAGTGGCCATGTATGTACACGCCTATACACTCTACAGCGCTGTTAGACCTTTTGGCTGCAGTT
TCATGTTGGGGTCTTACAGTGCGAATGATGGTGCACAGCTCTATATGATCGACCCATCAGGTGTTTCATA
TGGTTACTGGGGCTGTGCGATTGGCAAAGCCAGGCAGGCTGCAAAGACAGAGATAGAAAAGCTTCAGATG
AAGGAAATGACTTGCCGTGATGTAGTTAAAGAAGTTGCAAAAATAATTTACATAGTACACGATGAAGTTA
AAGATAAAGCTTTTGAACTGGAGCTCAGCTGGGTTGGTGAATTAACTAAAGGAAGACATGAAATTGTTCC
CAAAGACATAAGAGAGGAAGCAGAGAAATATGCCAAGGAATCTTTGAAGGAAGAAGATGAATCAGATGAT
GACAATATGTAATATTTTCTTCCCCATCCGCTGGTTTACATTTCTGTAACAGTTGCATATGGCTAGCACC
ATGGACTATATATACCCACTGACCGATTTTCATTAAATTTTGTCTTATAAACATAAAAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:5030475 using vector (pCMV-SPORT6) specific primers. Forward Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the probe sequence indicated here was given by the EURExpress Consortium and has been checked using a computational method whereby a BLAST comparison was made against the full insert sequence of IMAGE:5030475 which was retrieved directly from NCBI.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_001254 same experiment
 EMAGE:21575 same embryo
 EMAGE:21578 same embryo
 EMAGE:21579 same embryo
 EMAGE:21577 same embryo
 EMAGE:21576 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS