Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:21600

1110067D22Rik RIKEN cDNA 1110067D22 gene ( MGI:1916114)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:21600 EMAGE:21600 EMAGE:21600 EMAGE:21600 EMAGE:21600
"Pseudo-wholemount" of euxassay_002315. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_002315_01 euxassay_002315_02 euxassay_002315_03 euxassay_002315_04
EMAGE:21600 EMAGE:21600 EMAGE:21600 EMAGE:21600 EMAGE:21600
euxassay_002315_05 euxassay_002315_06 euxassay_002315_07 euxassay_002315_08 euxassay_002315_09
EMAGE:21600 EMAGE:21600 EMAGE:21600 EMAGE:21600 EMAGE:21600
euxassay_002315_10 euxassay_002315_11 euxassay_002315_12 euxassay_002315_13 euxassay_002315_14
EMAGE:21600 EMAGE:21600 EMAGE:21600 EMAGE:21600 EMAGE:21600
euxassay_002315_15 euxassay_002315_16 euxassay_002315_17 euxassay_002315_18 euxassay_002315_19
EMAGE:21600 EMAGE:21600 EMAGE:21600 EMAGE:21600
euxassay_002315_20 euxassay_002315_21 euxassay_002315_22 euxassay_002315_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:21600Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
21600_wholemount_strong.wlz
21600_wholemount_moderate.wlz
21600_wholemount_weak.wlz
21600_wholemount_possible.wlz
21600_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:21600_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
moderate moderate
regionalmoderate expression: see section 2 3 5 9 1
submandibular gland primordium
weak weak
regionalweak expression: see section 6 7 8 9 5 6 7
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 7 8 9 weak expression: see section 0 1 5 6 7
pectoral girdle and thoracic body wall skeleton
moderate moderate
regionalmoderate expression: see section 6 7 8 9 0 1 2 3 4 5 6 7 8
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3426
Entity Detected:1110067D22Rik, RIKEN cDNA 1110067D22 gene ( MGI:1916114)
Sequence:sense strand is shown

>T3426
GGGGATCCTGGGTGGGGTGTATTTATATATAATTTCGGTTTTGTTTGTACAGTGTATGTGTCTTATTAGG
GCACCTCTTTGTCCTTCGCTTCTAAGGTTTTTTACACAACATGCAGAGGCACTGAAGTGACCATGTCATC
TTCATGTGTCAAGAATGTAGACAGTGTTTCAGAACCAAAGTCTAAGATAAACAAAGCAAACTCAAATAAG
GAATCTTTATAGATGATATATTTGGATTCTTCTCAACTTTGAAACTGTTTAGCACAGTTCCATGGTGTTA
TATTCAAAGCCTTGTCCACCAAGACCTGCTGCGTCTTAAAAAACTTTCTGTTCTCATGGCTTCTCAGGCA
GCCAGGAGAGCTGTTTTGTAGCTCCAGGTTTTTATTTTGTTTTTTGTTTTTTTTAAAGCCTGTGAGCAAT
TTCTCATGGGTTGAAAAGCCACTTTAGAGGAGTGTCTGTCAAGAGACTTAGAACACACCCTGAAAAACAT
TTATGAGATTTGGATTCGATTCTTGCAGGTAA
Notes:The probe template was PCR amplified from IMAGE:3025888 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:3025888 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_002315 same experiment
 EMAGE:21601 same embryo
 EMAGE:21602 same embryo
 EMAGE:21603 same embryo
 EMAGE:21604 same embryo
 EMAGE:21605 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS