Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:21614

Rgs5 regulator of G-protein signaling 5 ( MGI:1098434)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:21614 EMAGE:21614 EMAGE:21614 EMAGE:21614 EMAGE:21614
"Pseudo-wholemount" of euxassay_005268. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_005268_01 euxassay_005268_02 euxassay_005268_03 euxassay_005268_04
EMAGE:21614 EMAGE:21614 EMAGE:21614 EMAGE:21614 EMAGE:21614
euxassay_005268_05 euxassay_005268_06 euxassay_005268_07 euxassay_005268_08 euxassay_005268_09
EMAGE:21614 EMAGE:21614 EMAGE:21614 EMAGE:21614 EMAGE:21614
euxassay_005268_10 euxassay_005268_11 euxassay_005268_12 euxassay_005268_13 euxassay_005268_14
EMAGE:21614 EMAGE:21614 EMAGE:21614 EMAGE:21614 EMAGE:21614
euxassay_005268_15 euxassay_005268_16 euxassay_005268_17 euxassay_005268_18 euxassay_005268_19
EMAGE:21614 EMAGE:21614 EMAGE:21614 EMAGE:21614
euxassay_005268_20 euxassay_005268_21 euxassay_005268_22 euxassay_005268_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:21614Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
21614_wholemount_strong.wlz
21614_wholemount_moderate.wlz
21614_wholemount_weak.wlz
21614_wholemount_possible.wlz
21614_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:21614_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
pericardium
moderate moderate
regionalmoderate expression: see section 8 9 0 1 2 3 4 5 6 weak expression: see section 7
mesenchyme
strong strong
regionalstrong expression: see section 1 2 3 4 5 6 7 8 9 0 4 5 6 7 8 9 0 1 2 3
thymus primordium
moderate moderate
regionalmoderate expression: see section 9 0 3 4 weak expression: see section 2
brain
strong strong
regionalstrong expression: see section 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 5 6 moderate expression: see section 8 9 0 1 2 3 4
aorta
strong strong
regionalstrong expression: see section 9 0 1 2 3 4
stomach
moderate moderate
regionalmoderate expression: see section 1 2 3 4 5 6 7 8
hindgut
moderate moderate
regionalmoderate expression: see section 1 2 3
midgut
moderate moderate
regionalmoderate expression: see section 7 8 9 0 1 2 3 4 5 6 7
lower jaw molar
moderate moderate
regionalmoderate expression: see section 7 7
palatal shelf
moderate moderate
regionalmoderate expression: see section 9 0 1 2 3 4 5
upper jaw molar
moderate moderate
regionalmoderate expression: see section 7 7
metanephros
moderate moderate
regionalmoderate expression: see section 5 6 7 3 4 5 6 7
male reproductive system
weak weak
regionalweak expression: see section 9 2
lung
moderate moderate
regionalmoderate expression: see section 2 3 4 5 6 7 8 9 weak expression: see section 2 3 5 6 7 8 9 1 0 1
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2697
Entity Detected:Rgs5, regulator of G-protein signaling 5 ( MGI:1098434)
Sequence:sense strand is shown

>T2697
GGCCTCGAGGCCAGATTCGGCACGAGGCCTGAAGTCTGAATTCAGTGAGGAAAACCTTGAGTTCTGGGTT
GCCAGTGAGAATTACAAGAAGATCAAGTCCCCCATCAAAATGGCGGAGAAGGCAAAGCAAATTTATGAAG
AATTCATCCAGACAGAGGCCCCTAAAGAGGTGAACATTGACCACTTCACTAAAGACATCACCATGAAGAA
CCTGGTGGAACCGTCTCCTCGCAGCTTTGACTTGGCCCAGAAAAGGATCTATGCCCTGATGGAGAAGGAT
TCTCTGCCCCGCTTTGTGCGCTCTGAATTTTATAAGGAGCTAATCAAGTAGTCATCTGGTCAGGCTTCCA
AAAGTTGCCCTGTGAGTTGAGTTACATCCTTTGTAGCAACACAGCATCCTCCCAGGCACCTGCACAGTTC
TCCATAGCAGCTTTGCTCCAAGATACACAAACATAGGCAAACCACAGGCTGTGTTGCTAACTCTTTCGCT
CATGTTAGTTTGGTTATGTGGATCTGTTGTCTAAGAGCCCTCACTTTTTTCTTTTTCTTTTTTTTTTCTT
TTTTT
Notes:The probe template was PCR amplified from IMAGE:1512124 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1512124 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_005268 same experiment
 EMAGE:21616 same embryo
 EMAGE:21615 same embryo
 EMAGE:21617 same embryo
 EMAGE:21613 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS