Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:21615

Ebf3 early B-cell factor 3 ( MGI:894289)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:21615 EMAGE:21615 EMAGE:21615 EMAGE:21615 EMAGE:21615
"Pseudo-wholemount" of euxassay_005263. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_005263_01 euxassay_005263_02 euxassay_005263_03 euxassay_005263_04
EMAGE:21615 EMAGE:21615 EMAGE:21615 EMAGE:21615 EMAGE:21615
euxassay_005263_05 euxassay_005263_06 euxassay_005263_07 euxassay_005263_08 euxassay_005263_09
EMAGE:21615 EMAGE:21615 EMAGE:21615 EMAGE:21615 EMAGE:21615
euxassay_005263_10 euxassay_005263_11 euxassay_005263_12 euxassay_005263_13 euxassay_005263_14
EMAGE:21615 EMAGE:21615 EMAGE:21615 EMAGE:21615 EMAGE:21615
euxassay_005263_15 euxassay_005263_16 euxassay_005263_17 euxassay_005263_18 euxassay_005263_19
EMAGE:21615 EMAGE:21615 EMAGE:21615 EMAGE:21615
euxassay_005263_20 euxassay_005263_21 euxassay_005263_22 euxassay_005263_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:21615Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
21615_wholemount_strong.wlz
21615_wholemount_moderate.wlz
21615_wholemount_weak.wlz
21615_wholemount_possible.wlz
21615_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:21615_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
hand
moderate moderate
regionalmoderate expression: see section 2 3 4 2 3
foot
moderate moderate
regionalmoderate expression: see section 4 5 6 7 8 9 0 1
upper leg rest of mesenchyme
moderate moderate
regionalmoderate expression: see section 0 1 2 3
mesenchyme
moderate moderate
regionalmoderate expression: see section 1 2 3 4 5 6 7 2 3 4 5 6 7 8 9 0 1 2 3
vibrissa
strong strong
regionalstrong expression: see section 5 6 8 9 0 moderate expression: see section 7 7
hypothalamus mantle layer
strong strong
regionalstrong expression: see section 7 8 9 0 1 2 3 4
diencephalon lateral wall mantle layer
strong strong
regionalstrong expression: see section 6 7 8 9 0 1 2 3 4
telencephalon meninges
strong strong
regionalstrong expression: see section 3 0 1 2 moderate expression: see section 1 2 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9
medulla oblongata alar plate mantle layer
strong strong
homogeneousstrong expression: see section 5 6 7 8 9 0 1 2 3 4 5
medulla oblongata basal plate mantle layer
strong strong
homogeneousstrong expression: see section 5 6 7 8 9 0 1 2 3 4 5
rest of cerebellum mantle layer
strong strong
homogeneousstrong expression: see section 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9
pons mantle layer
strong strong
homogeneousstrong expression: see section 4 5 6 7 8 9 0 1 2 3 4 5 6 7
midbrain mantle layer
strong strong
homogeneousstrong expression: see section 3 4 5 6 7 8 9 0 1 2 3 4 5 6
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 2 3 4 5 6 7 5 6 7 8 9 0
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 5 6 7 8
spinal cord mantle layer
strong strong
homogeneousstrong expression: see section 7 8 9 0 1 2 3 4
dorsal root ganglion
strong strong
regionalstrong expression: see section 7 moderate expression: see section 5 6 8 9 3 4 5
neural retina
strong strong
regionalstrong expression: see section 1 2 3 0 1 2 3
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 7 8 9 0 1 3 4 5 6 7
vomeronasal organ
strong strong
regionalstrong expression: see section 1 4
tongue muscle
weak weak
regionalweak expression: see section 1 2 3 4
lung
moderate moderate
regionalmoderate expression: see section 1 weak expression: see section 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1
sternum
moderate moderate
regionalmoderate expression: see section 7 8 9 0 1 3 4 5
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2679
Entity Detected:Ebf3, early B-cell factor 3 ( MGI:894289)
Sequence:sense strand is shown

>T2679
GGCCTCGAGCCAGATTCGGCACGAGGATGAAACTTTGTAACTTATTGTAGTTAGAAATTGTAACTTTGAT
ATCGAATCTCTTGCCTTCAACAAGCACACTGACAGAGAAAAAAAAATATGCTACTGTCTGTTGGTTCCAA
TATTCTCCCACCTAGAGCTTCCTGTTAAAGCAAGTGCGATCAGCAACATTTTTCAACTTTCGCGCACTGT
AAACCTATTGCATTCTTAGGCTACTGTGAGGTCTATGTTTCTTGTACCTGAAATTGTCCTTTGGACTCCT
AGACCCTTCTTCCCCGATGTGTTTTGTATGTGGTTATAAAATTGTAGACTTTTGTGATTTTGCCAAAGTT
GTAGCTAAATATTTATACACTTGTCTTGAATTTTTTTTCAGATCCACTTAAAATATTTAGAAAAACGAGT
TTTATTCCTTATGGGTCTTATAGGGGATAAAATGCTCTTCTTCCATGCGACACTTCCTTTCCCATGAACA
CTTGCAGTTGCTAAGGGACTTTATTTTGTAACATATTAATTATAAATATTGTATTTATCTTTGAAATTTT
GTACATTGCTTTCCCTGCCTTCTTTT
Notes:The probe template was PCR amplified from IMAGE:1511771 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1511771 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_005263 same experiment
 EMAGE:21616 same embryo
 EMAGE:21617 same embryo
 EMAGE:21614 same embryo
 EMAGE:21613 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS