Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:21617

Mrap melanocortin 2 receptor accessory protein ( MGI:1924287)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:21617 EMAGE:21617 EMAGE:21617 EMAGE:21617 EMAGE:21617
"Pseudo-wholemount" of euxassay_005267. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_005267_01 euxassay_005267_02 euxassay_005267_03 euxassay_005267_04
EMAGE:21617 EMAGE:21617 EMAGE:21617 EMAGE:21617 EMAGE:21617
euxassay_005267_05 euxassay_005267_06 euxassay_005267_07 euxassay_005267_08 euxassay_005267_09
EMAGE:21617 EMAGE:21617 EMAGE:21617 EMAGE:21617 EMAGE:21617
euxassay_005267_10 euxassay_005267_11 euxassay_005267_12 euxassay_005267_13 euxassay_005267_14
EMAGE:21617 EMAGE:21617 EMAGE:21617 EMAGE:21617 EMAGE:21617
euxassay_005267_15 euxassay_005267_16 euxassay_005267_17 euxassay_005267_18 euxassay_005267_19
EMAGE:21617 EMAGE:21617 EMAGE:21617
euxassay_005267_20 euxassay_005267_21 euxassay_005267_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:21617Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
21617_wholemount_strong.wlz
21617_wholemount_moderate.wlz
21617_wholemount_weak.wlz
21617_wholemount_possible.wlz
21617_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:21617_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
adrenal gland
strong strong
regionalstrong expression: see section 6 7 4 moderate expression: see section 8 5 6
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 6 7 8 9
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 7 8 moderate expression: see section 8 9 0 5 6
rectum
weak weak
regionalweak expression: see section 2
bladder
weak weak
regionalweak expression: see section 1 2
kidney calyx
strong strong
regionalstrong expression: see section 5 6 7 8 9 4 5 6 7 8
kidney pelvis
strong strong
regionalstrong expression: see section 7 6
urethra of male
weak weak
regionalweak expression: see section 2
lung
strong strong
regionalstrong expression: see section 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2
trachea
strong strong
regionalstrong expression: see section 3 weak expression: see section 2
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2620
Entity Detected:Mrap, melanocortin 2 receptor accessory protein ( MGI:1924287)
Sequence:sense strand is shown

>T2620
TGGCCTCGAGCAGATTCGGACGAGGGGAAGCCGCGTCTCTAGTAGCCTTTGGAGGTTTGTCCAGGAGAGA
CAGGAACCAGAAGCCCTACAGGGGAACGGCCCCCTGACCTTCCAGCCATGCAGCTCTGATAAGTAGGCAG
GCCCCATGCCGGGAGAGCCACAGACAAGCCGGGTGATTCTGATAGAAATTAGTTAAGCAATCTTGTCTCT
GGGGCTCACGGCCCAGCTGTGGGTGCGAGCCTCTGACAGACACTGTCGTCAAAGCCACAGTCATGGCCAA
CGGGACCGACGCCTCTGTCCCGCTCACCAGCTATGAGTATTACCTGGACTACATAGACCTCATTCCTGTG
GACGAGAAGAAGCTGAAAGCCAACAAGCATTCCATTGTCATCGCCCTGTGGTTGAGCCTGGCTACCTTCG
TGGTGCTCCTCTTTCTCATCCTGCTCTACATGTCCTGGTCGGGCTCCCCACAGATGAGGCACAGTCCCCA
ACCCCAGCCAATATGTTCATGGACTCACAGCTTCAACCTCCCTCTGTGCCTCCGGAGGG
Notes:The probe template was PCR amplified from IMAGE:1400678 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1400678 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_005267 same experiment
 EMAGE:21616 same embryo
 EMAGE:21615 same embryo
 EMAGE:21614 same embryo
 EMAGE:21613 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS