Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:21666

Plagl1 pleiomorphic adenoma gene-like 1 ( MGI:1100874)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:21666 EMAGE:21666 EMAGE:21666 EMAGE:21666 EMAGE:21666
"Pseudo-wholemount" of euxassay_009026. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009026_01 euxassay_009026_02 euxassay_009026_03 euxassay_009026_04
EMAGE:21666 EMAGE:21666 EMAGE:21666 EMAGE:21666 EMAGE:21666
euxassay_009026_05 euxassay_009026_06 euxassay_009026_07 euxassay_009026_08 euxassay_009026_09
EMAGE:21666 EMAGE:21666 EMAGE:21666 EMAGE:21666 EMAGE:21666
euxassay_009026_10 euxassay_009026_11 euxassay_009026_12 euxassay_009026_13 euxassay_009026_14
EMAGE:21666 EMAGE:21666 EMAGE:21666 EMAGE:21666 EMAGE:21666
euxassay_009026_15 euxassay_009026_16 euxassay_009026_17 euxassay_009026_18 euxassay_009026_19
EMAGE:21666
euxassay_009026_20

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:21666Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
21666_wholemount_strong.wlz
21666_wholemount_moderate.wlz
21666_wholemount_weak.wlz
21666_wholemount_possible.wlz
21666_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:21666_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
mesenchyme
moderate moderate
regionalmoderate expression: see section 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0
hypothalamus ventricular layer
weak weak
regionalweak expression: see section 8 9 0 1 2 3 4 5
diencephalon lateral wall ventricular layer
weak weak
regionalweak expression: see section 0 1 2 3 4
telencephalon ventricular layer
weak weak
regionalweak expression: see section 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0
pons ventricular layer
weak weak
regionalweak expression: see section 5 6 7 4 5 6
metencephalon part of 4th ventricle choroid plexus
weak weak
regionalweak expression: see section 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6
midbrain ventricular layer
weak weak
regionalweak expression: see section 4 5 6 7 8 9 0 1 2 3 4
otic capsule
moderate moderate
regionalmoderate expression: see section 5 6 7 4
neural retina
moderate moderate
regionalmoderate expression: see section 2 3 4 5
exoccipital bone
strong strong
regionalstrong expression: see section 1 2 3 4 5 6 7 8 9 0
temporal bone petrous part
strong strong
regionalstrong expression: see section 1 2 3 4 6 7 8 9 0
orbito-sphenoid
strong strong
regionalstrong expression: see section 1 2 3 7 8 3 8 9 0
viscerocranium
strong strong
regionalstrong expression: see section 9 0 1 2 3 8 9 0
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35516
Entity Detected:Plagl1, pleiomorphic adenoma gene-like 1 ( MGI:1100874)
Sequence:sense strand is shown

>T35516
GCTGATGCAAGAGAATATGCAGGCAGGAGATTACCAGAGCAATTTCCAACTCATTGCGCCTTCAACTTCG
TTCCAGATAAAGGTTGATCCCATGCCTCCTTTCCAGCTAGGAGCGGCTCCCGAGAACGGGCTTGATGGTG
GCTTGCCACCCGAGGTTCATGGTCTAGTGCTTGCTGCCCCAGAAGAAGCTCCCCAACCCATGCCGCCCTT
GGAGCCTTTGGAGCCTTTGGAGCCTTTGGAGCCTTTGGAGCCGATGCAGTCTTTGGAGCCTTTGCAGCCT
TTGGAGCCGATGCAGCCTTTGGAGCCAATGCAGCCTTTGGAGCCGATGCAGCCTTTAGAGCCTTTGGAGC
CTCTGGAGCCGATGCAGCCTTTGGAGCCGATGCAGCCTTTGGAGCCTATGCAGCCAATGCTGCCAATGCA
GCCAATGCAGCCAATGCAGCCAATGCAGCCAATGCTGCCAATGCAGCCAATGCTGCCAATGCAGCCAATG
CAGCCAATGCAGCCAATGCTGCCAATGCCAGAGCCGTCTTTCACTCTGCACCCTGGCGTAGTTCCCACCT
CTCCTCCCCCAATTATTCTTCAGGAGCATAAGTATAATCCTGTTCCTACCTCATATGCCCCATTTGTAGG
CATGCCCGTCAAAGCAGATGGCAAGGCCTTTTGCAACGTGGGTTTCTTTGAGGAATTTCCTCTGCAAGAG
CCTCAGGCGCCTCTCAAGTTCAACCCATGTTTTGAGATGCCTATGGAGGGGTTTGGGAAAGT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 98829. Forward Primer - name:098829_F_cDNA_Plagl1, sequence:GCTGATGCAAGAGAATATGCAG; Reverse Primer - name:098829_N_SP6_cDNA_Plagl1, sequence:ACTTTCCCAAACCCCTCCATA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_009026 same experiment
 EMAGE:21667 same embryo
 EMAGE:21669 same embryo
 EMAGE:21668 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS